search for: bakshi

Hello Erwan and others, I am running HDT from grub2 with memdisk. I have informed the success of booting hdt to the grub2 list. Some developers are very much interested to this issue and they are showing their interest to make a glue between com32 and grub2 so that hdt can be loaded without memdisk. It is really very exciting to have hdt as an inbuilt feature of grub2. Could any one kindly

...s<- lapply(2:ncol(dat2),function(i) {x1<- combn(names(dat2),i);unlist(lapply(1:ncol(x1), function(i) {x2<- dat2[,x1[,i]];dim(x2[!as.logical(rowSums(x2==0)),])[1]}))}) res #[[1]] #[1] 6 7 6 6 5 6 #[[2]] #[1] 6 5 6 5 # #[[3]] #[1] 5 A.K. ________________________________ From: Utpal Bakshi <utpalmtbi at gmail.com> To: arun <smartpink111 at yahoo.com> Sent: Saturday, March 2, 2013 2:14 PM Subject: Re: explanation of the problem.. may be you could use the specaccum function of vegan package for permutations.. the function is shown in pan genome script file.. On Sun,...

...s path = /tmp browseable = yes printable = yes public = yes guest ok = yes [shared] comment = Public Shared Folder path = /home/shared browseable = yes guest only = yes writable = yes public = yes ############################################# -- ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Joydeep Bakshi, Linux System Admin Kolkatainfoservices Pvt Ltd, 23A Royd Street, Kolkata 700016, India Work Phone 91 033 40014784 http://infoservices.in/ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

...'Device was successfully created.'' 25 redirect_to :action => ''list'' 26 else 27 render :action => ''new'' 28 end 29 end Thanks in advance of any suggestions to this problem. Regards Chetan -- Srijan Technologies Pvt. Ltd. 304 Bakshi House, 40-41 Nehru Place, New Delhi - 110019 INDIA Ph: 91-11-2622 5926/ 5931 Fax: 91-11-5160 8543 Email: info@srijan.in Web: www.srijan.in ---------------------- See our Typo3 demos at: http://demos.srijansoft.com

HAPPY NEW YEAR from my I&iPhone -- You received this message because you are subscribed to the Google Groups "Ruby on Rails: Talk" group. To post to this group, send email to rubyonrails-talk-/JYPxA39Uh5TLH3MbocFF+G/Ez6ZCGd0@public.gmane.org To unsubscribe from this group, send email to rubyonrails-talk+unsubscribe-/JYPxA39Uh5TLH3MbocFF+G/Ez6ZCGd0@public.gmane.org For more

Dear list, I have a password-less samba shared and it is used successfully from window PCs. I also like to make an auto-mount for linux pcs so that it can be used from linux boxes. To achieve this I have made an entry in /etc/fstab as ``````````````````````` //192.168.1.1/shared /home/test/serverdisk cifs user,rw 0 0 ```````````````````` As root I can mount it and see all the contents of

Hi I use mongoid for rails application and I try to do @users = User.where("first_name = ? OR last_name = ? OR type = ?", firstname, lastname, usertype) but I am getting error but when i put: @users = User.where(:first_name => firstname, :last_name => lastname, :type => usertype).all the program run successfully but i need OR to execute in mongodb Also I need sql LIKE to

Hello list, I am trying to make a very simple samba share with out any authentication which will work inside the lan only and accessible from winxp too. This is debian lenny box and samba is 2:3.2.5-4lenny7 To achieve this I have written smb.conf ( collected from testparm as ) ``````````````````````````````````` Load smb config files from /etc/samba/smb.conf Processing section

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789

Dear list, I have no in depth knowledge about samba but use the online tutorial to configure the samba server. this time I have installed samba ( Version 3.2.4-4.3-2042-SUSE-SL11.0 ) on suse 11. I have now disallowed the guest users and created some samba users with "smbpasswd -a <username> " command. but if I try to connect with the samba share from another linux box I get

Dear developers, Thanks a lot for designing HDT. It is really a great tool to have. I have come here to know more about the usability of HDT. HDT is called by syslinux. What to do if I like to call it by grub2 ? and what to do if I like to run within my debian box ? Thanks

Hi I had a IDE netbeans now I have installed red car but after installing redcar my NETBEANS not working so I want to remove redcar from my local machine(ubuntu 10.10) when I put this in console: > sudo gem uninstall redcar I got WARNING: Invalid .gemspec format in ''/usr/lib/ruby/gems/1.8/specifications/redcar-0.13.gemspec'' ERROR: While executing gem ...