search for: atg

for example: > a$tic[1:10] [1] "AIR " "ABCB " "ABXA " "ACMR " "ADCT " "ADEX " [7] "ABM " "AFCE " "AG " "ATG " Can anyone please tell me how to strip the white spaces from a$tic? Thanks, Roger [[alternative HTML version deleted]]

...Redhat-EL4 and otherwise nearly identical hardware (2.8/3GHz, 1GB RAM each). The source machine has a SCSI-RAID1, the destination a SATA-RAID1 disk attached. There are 5 filesystems which are rsynced via ssh. On the smaller filesystems with ~200.000 files/7GB, rsync takes 1-3 minutes: lion:/atg/ ========= Tue Aug 22 12:13:29 CEST 2006 ================== receiving file list ... done --<snip-snip>-- Number of files: 233780 Number of files transferred: 2 Total file size: 6716087965 bytes Total transferred file size: 1470 bytes Literal data: 1470 bytes Matc...

We're looking for a laptop to run in a 10,000', cold, occasionally wet environment, and it needs to run CentOS 5. Perhaps something like the Dell Latitude E6400 ATG? There's a reference to a minor trackball bug for the 6400 under CentOS 5 (http://bugs.centos.org/view.php?id=4192) but otherwise it sounds like the x86_64 version should run on it. Ideally the system would use a SSD too. Any suggestions?

...pecify given breaks. My data look like this: > head(Maji) Country waterused CC 1 Afghanistan 36 AFG 2 Albania 4 ALB 3 Algeria 52 DZA 4 Angola 0 AGO 5 Antigua 10 ATG 6 Argentina 4 ARG and when I attempt, > classInt <- classIntervals(ww[["waterused"]], n=5, style="fixed", fixedBreaks=c(0, 25,50,75,100,4565)) *Warning message:* *In classIntervals(ww[["waterused"]], n = 5, style = "fixed", fixe...

...DSL: class {"test": } I get this as an error: err: Could not retrieve catalog from remote server: Error 400 on SERVER: Puppet::Parser::AST::Resource failed with error NoMethodError: undefined method `safeevaluate'' for "blah":String at /data/puppet/nbenns/modules/atg/manifests/init.pp:56 on node <removed> If I add the parameter in its fine. If :arguments => { :param1 => "blah" } isn''t used as :arguments => { paramname => default value } then what is it? the documentation isn''t clear at all on this. Thanks. --...

...6 SYNONYMOUS_CODING 264 27 9 P ccC/ccT rs41284843 7 SYNONYMOUS_CODING 365 27 9 P ccC/ccT rs41284843 8 NMD_TRANSCRIPT,SYNONYMOUS_CODING 264 27 9 P ccC/ccT rs41284843 9 NON_SYNONYMOUS_CODING 1330 1173 391 I/M atA/atG rs3729680 10 NON_SYNONYMOUS_CODING 1468 1064 355 G/D gGt/gAt rs61744960 11 NON_SYNONYMOUS_CODING 1204 1064 355 G/D gGt/gAt rs61744960 12 NON_SYNONYMOUS_CODING 1924 1064 355 G/D gGt/gAt rs61744960 13 NON_SYNONYMOUS_CODING 1924 1064 3...

...ferent license files that are loaded on thirteen servers. Not every license goes on every server. I''d like to serve the files only if they exist on the puppet master server. I''m thinking of doing it like this: define install_license($host) { if(exists("/var/puppet/modules/atg/files/${host}/${name}")){ file { $name: path => "${dynamo_home}/localconfig/${name}", mode => $mode, owner => $owner, group => $group, source => "puppet://puppet.armstrong.com/atg/${host}/$ {name}",...

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... > uco(newdata5,index="rscu") aaa aac aag aat aca acc acg act aga agc agg agt ata atc atg att caa cac cag cat NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA...

...ox. I tried to reinstall java and this did not work either. Any ideas? Eric -- Eric Kaufmann | Application Support Analyst - Advanced Technology Group | Saint Louis University | 314-977-2257 | kaufmann at slu.edu | Interested in High Performance Computing? Visit us at http://rocks64.slu.edu/atg . -------------- next part -------------- An HTML attachment was scrubbed... URL: <http://lists.centos.org/pipermail/centos/attachments/20110419/b5e14501/attachment-0005.html>

...: > iso continent code code3 codenum country 1 EU AD AND 20 Andorra, Principality of 2 AS AE ARE 784 United Arab Emirates 3 AS AF AFG 4 Afghanistan, Islamic Republic of 4 NA AG ATG 28 Antigua and Barbuda 5 NA AI AIA 660 Anguilla 159 AF NA NAM 516 Namibia, Republic of ... 246 AF ZW ZWE 716 Zimbabwe, Republic of and > rawdata idno alter sex cctld capacity...

I''m trying to start RubyGems on my hd. Windows searches for and can''t find a file named gemhelp.cmd Can I download that files somewhere? -- Posted via http://www.ruby-forum.com/.

...y resembling this card. This troubles me. When I do the "modprobe wctdm" (as prescribed in http://www.digium.com/index.php?menu=configuration#TDM11B <http://www.digium.com/index.php?menu=configuration#TDM11B> , I have all my conf files configured per this site), I get: [root@atg-sandbox-rh root]# modprobe zaptel [root@atg-sandbox-rh root]# modprobe wctdm /lib/modules/2.4.21-27.ELsmp/misc/wctdm.o: init_module: No such device Hint: insmod errors can be caused by incorrect module parameters, including invalid IO or IRQ parameters You may find more information in syslog or...

...erry suggested above and I am not sure How to masqerade the loc isp. Also it is not clear to me which interface (nic) Jerry is reffering to apply a /32 mask on. also posted routing below Here is the config I have now? /etc/shorewall providers loc 1 256 main eth1 10.194.79.254 track,balance eth1 atg 2 512 main eth0 66.224.62.97 track,balance eth1 /etc/shorewall/masq eth0 10.194.79.181 66.224.62.120 eth1 66.224.62.120 10.194.79.181 eth0 eth1 66.224.62.120 eth1 eth1 10.194.79.181 ns5:~ # shorewall show routing Can''t determine the IP address of eth2 Shorewall...

...ll me how to strip the white spaces > from a character vector? > > > for example: > > a$tic[1:10] > [1] "AIR " "ABCB " "ABXA " "ACMR " "ADCT " "ADEX " > [7] "ABM " "AFCE " "AG " "ATG " > Can anyone please tell me how to strip the white spaces from a$tic? > Thanks, > Roger > > [[alternative HTML version deleted]] > > ______________________________________________ > R-help at stat.math.ethz.ch mailing list > https://stat.ethz.ch/mailman/listi...

...***************************************************** Session length: 0 hour(s), 0 minute(s) and 7.340 second(s) ******************************************************************************************************************************************* EmExceptionHandler v1.1 (c)2005 Sumo Digital ATG *******************************************************************************************************************************************

...ck's Vista Horror story in last issue has a follow-up. He wrote: "I MAY have finally turned the corner on Vista turning me gray and bald, although what little hair I have left after the last 4 weeks is definitely going gray :) I bought a MS Wireless Desktop 1000 to install on that Latitude ATG 620 with Vista Business that has been torturing me. Certified for Vista. Install Intellipoint 6.1 off the disk. Plug in the receiver. No joy. It wants the disk. Says the disk has no drivers. WTF. Download and install Intellipoint 6.2. Plug in the receiver. No joy. It wants the disk. Now, we've...

...s are stored in a vector of strings. There is an additional vector of the same length that provides the indices to the DNA sequences. Finally, I have output from table() that gives the distribution of indices in the population. It looks something like this: seqindex 1,2,3,4,5 sequences "ATG","ATC","AAT","CTT","GTC" table() output of seqindex frequencies: 1 2 3 4 5 6 10 5 1 7 The sequences are usually around 100 characters long (rather than 3) and there can be several hundred different unique sequences and the freqen...

Buenas, Me encuentro con el mismo problema, de que me dice que el argumento del if no es un "valor ausente donde TRUE/FALSE es necesario" Este es mi codigo de pruebas. readseq <- "aaaaaaaaaaa", "aaa", "aa") auxiliar <- count(readseq[j],i+2) aux_a <- auxiliar["listaa"] if(aux_a > 0){ matrizgraf3[i][k] = matrizgraf3[i][k] + 1 listaa

{atlas:307 root} tail log.smb [1999/01/28 17:20:55, 3] param/loadparm.c:lp_add_ipc(1478) adding IPC service [1999/01/28 17:20:55, 2] lib/interface.c:interpret_interfaces(213) Added interface ip=205.181.94.124 bcast=205.181.94.255 nmask=255.255.255.0 [1999/01/28 17:20:55, 1] smbd/files.c:file_init(219) file_init: Information only: requested 10000 open files, 1014 are available. [1999/01/28