Displaying 1 result from an estimated 1 matches for "atcacacaacgacactcaccctggacgctcatc".
2009 Jan 22
0
write.fasta (seqinr package)
...to use 'write.fasta(sequences, names, nbchar = 60, file.out, open = "w")' to convert a DNA sequence in a text file to fasta format.
How do I read the the text file to prepare the argument 'sequences' of the function.
The DNA sequence in the text file is one line as below:
ATCACACAACGACACTCACCCTGGACGCTCATC.........
Thank you
[[alternative HTML version deleted]]