search for: atc

The 7th International Conference on Autonomic and Trusted Computing (ATC 2010) Call for Demos and Exhibition Highlight: ATC demos will be published on IEEE CS proceedings (indexed by EI)! The ATC 2010 demo/exhibition program provides researchers and engineers with opportunities to show their cutting-edge work presented in an interactive fas...

The 7th International Conference on Autonomic and Trusted Computing (ATC 2010) Call for Demos and Exhibition Highlight: ATC demos will be published on IEEE CS proceedings (indexed by EI)! The ATC 2010 demo/exhibition program provides researchers and engineers with opportunities to show their cutting-edge work presented in an interactive fas...

Call for Demos and Exhibition The 7th International Conference on Autonomic and Trusted Computing (ATC 2010) Xi'an China, October 26-29, 2010 http://www.nwpu.edu.cn/atc2010/ The ATC 2010 demo/exhibition program provides researchers and engineers with opportunities to show their cutting-edge work presented in an interactive fashion. The live demonstrations and exhibitions may include imple...

Call for Demos and Exhibition The 7th International Conference on Autonomic and Trusted Computing (ATC 2010) Xi'an China, October 26-29, 2010 http://www.nwpu.edu.cn/atc2010/ The ATC 2010 demo/exhibition program provides researchers and engineers with opportunities to show their cutting-edge work presented in an interactive fashion. The live demonstrations and exhibitions may include imple...

I am new to Wine and anything like it. I want to run the application "ATCS Monitor". When I installed ATCS Monitor I received an error message: C:\windows\system32\wshom.ocx Unable to register the DLL/OCX: RegSvr32 failed with exit code 0x1 -From Terminal- err:typelib:sltg_get_typelib_ref Unable to find reference err:module:import_dll Library ScrRun.dll (which...

...rd01. We are currently running OCFS2 1.2.5, the kernel is EL4 Update 5 x86_64 (2.6.9-55.ELsmp). I see there is one bug fixed in 1.2.6/1.2.7 related to DLM and I was wondering if the above problem could be related to it or if this is something different. Ulf Zimmermann | Senior System Architect ATC-Onlane, Inc. 4600 Bohannon Drive, Suite 100 Menlo Park, CA 94025 O: 650-532-6382 M: (510) 396-1764 F: (510) 580-0929 Email: ulf@atc-onlane.com | Web: www.atc-onlane.com DISCLAIMER: This e-mail and any attachments are confidential and also may be privileged. If you are not the named recipient,...

...clock in my HVM domU. I''ve already disabled network-based time synchronization inside the HVM. I''ve tried setting /proc/sys/xen/independent_wallclock=1 and then restarting xend, but the guest still gets the correct time. Any ideas on how to accomplish this? Steve Brueckner, ATC-NY _______________________________________________ Xen-users mailing list Xen-users@lists.xensource.com http://lists.xensource.com/xen-users

...assdb/pdb_ldap.c:ldapsam_search_one_group(2170) ldapsam_search_one_group: Problem during the LDAP search: LDAP error: (unknown) (Time limit exceeded) Here's some setting in smb.conf security = user passdb backend = ldapsam:ldap://localhost ldap admin dn = cn=admin ldap suffix = dc=local,dc=atc ldap user suffix = ou=People ldap machine suffix = ou=Computers ldap group suffix = ou=Groups

...ing I find seems to indicate I have to unmount, run /etc/init.d/ocfs2 stop, /etc/init.d/o2cb restart and then /etc/init.d/ocfs2 start. Is there no way of telling o2cb there are two new nodes? Like a /etc/init.d/o2cb reconfigure? --------------------------------------------------------------------- ATC-Onlane Inc., T: 650-532-6382, F: 650-532-6441 4600 Bohannon Drive, Suite 100, Menlo Park, CA 94025 ---------------------------------------------------------------------

Karsten M. Self wrote: > on Thu, Dec 15, 2005 at 01:38:29PM -0500, Steve Brueckner > (steve@atc-nycorp.com) wrote: >> I''m using Fedora Core 4. I need to create an ssh port forwarding >> tunnel to my xen0 domain when my xenU domain starts up, so I added >> this to the xenU''s /etc/rc.d/rc.local: >> >> ssh -v -f -L 5500:localhost:5501 xen0_ip ta...

...bviously will go through and recover the journal but unless I mount/umount the volume once, tunefs will come back with dirty file system. Are there any other steps I should be doing or does this sequence look ok? Regards, Ulf. --------------------------------------------------------------------- ATC-Onlane Inc., T: 650-532-6382, F: 650-532-6441 4600 Bohannon Drive, Suite 100, Menlo Park, CA 94025 ---------------------------------------------------------------------

Xen Community: I have been asked by Steve Brueckner of ATC-NY and some of his colleagues to create a new Xen.org project - Xen Introspection Project: to design an API for performing VM introspection and implementing the necessary functionality into Xen. If you are interested, please email me back and I will add you to the project member list. I will be sen...

Xen Community: I have been asked by Steve Brueckner of ATC-NY and some of his colleagues to create a new Xen.org project - Xen Introspection Project: to design an API for performing VM introspection and implementing the necessary functionality into Xen. If you are interested, please email me back and I will add you to the project member list. I will be sen...

Xen Community: I have been asked by Steve Brueckner of ATC-NY and some of his colleagues to create a new Xen.org project - Xen Introspection Project: to design an API for performing VM introspection and implementing the necessary functionality into Xen. If you are interested, please email me back and I will add you to the project member list. I will be sen...

I ran into the following error message : ---snipp--- Call kernel32.495: LoadLibraryA(102951c8 "ctmp3Lib.dll") ret=1025f5ad fs=008f Call kernel32.922: __wine_register_dll_16(418ff5ac) ret=418bd4f0 fs=008f Ret kernel32.922: __wine_register_dll_16() retval=418ff5ac ret=418bd4f0 fs=008f err:win32:fixup_imports No implementation for NTDLL.dll.3(IoUnregisterDeviceInterface), setting to

Hi    We are extremely happy to announce ConVirt 1.1 release. For details please visit : http://www.convirture.com/blog/2009/announcements/convirt-11-is-now-available/ ConVirt Team. _______________________________________________ Xen-users mailing list Xen-users@lists.xensource.com http://lists.xensource.com/xen-users

...osts host wins bcast ####AUTENTIFICACION###### security = user encrypt passwords = true passdb backend = ldapsam:ldaps://shogun.ironman.es:636 ; guest account = guest invalid users = root unix password sync = no ; ldap passwd sync = yes passwd program = /usr/sbin/changepasswd.atc -o %u passwd chat = *Enter\snew\sUNIX\spassword:* %n\n *Retype\snew\sUNIX\spassword:* %n\n . ; obey pam restrictions = yes ; pam password change = no #####LDAP##### ldap admin dn = cn=admin,dc=ironman,dc=es ldap ssl = on ldap delete dn = no ldap suffix = dc=ironman,dc=es...

...n even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... > uco(newdata5,index="rscu") aaa aac aag aat aca acc acg act aga agc agg agt ata atc atg att caa cac cag cat NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA cca ccc ccg cct cga cgc cgg cgt cta ctc ctg ctt gaa gac gag gat gca gcc gcg gct NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA gga ggc ggg ggt gta gtc gtg gtt...

...#39;) xend-debug.log gives me this: ERROR: do_evtchn_op: HYPERVISOR_event_channel_op failed: -1 And xend.log spews out all of the stuff below my sig. I''ve googled around and not found any obvious answers. Can anyone tell me where to start looking to fix this? Thanks, Steve Brueckner, ATC-NY [2006-05-18 14:48:06 xend.XendDomainInfo] DEBUG (XendDomainInfo:184) XendDomainInfo.create([''vm'', [''name'', ''winxp''], [''memory'', 512], [''vcpus'', 1], [''image'', [''hvm'', [...

...o Ctrl-A three times to connect, nothing happens. The debuggee boots find and gives me the login screen as normal. Is there a special time to hit the Ctrl-A in minicom? Should the kernel wait for a connection from gdb? I''ve tried various combinations of using nsplitd and a serial-split patch I found mentioned on mailing lists and setting the boot flags to com=1H and com=1. Nothing seems to work. Is the gdb stub working with this version of the code? I have checked the serial connection by connecting minicom to the port and from the remote machine doing the command "echo test &...