search for: asdfasdf

I don''t like this: i = mock(Integer) i.should_receive(:asdfasdf).and_return(''foo'') puts i.asdfasdf Shouldn''t rspec check to see that :asdfasdf is a valid message to be sending Integer? Joe

Hi all, I'm using R to find duplicates in a set of 6 files containing Part Number information. Before applying the intersect method to identify the duplicates I need to normalize the P/Ns. Converting the P/N to uppercase if alphanumerical and applying an 18 char long zero padding if numerical. When I apply the pn_formatting function (see code below) to "Part Number" column of the

jÇ_jÇ_

> > If we do end up creating ARM binaries for the general public, your input > > and expertise will be greatly appreciated! ;) > I will be happy to provide some Debian & Ubuntu ARM packages. I just > need access to ARM server(s). I don't know if there is such server available. If so, I also would like give help. :) Regards, chenwj -- Wei-Ren Chen (陳韋任) Computer

...lt;p>Class: <%= @item.class %><br /> Name: <%= @item.name %></p> ----------------- spec/fixtures/admin_notify/itemcreated : <p><b>AdminNotify#itemcreated</b></p> <p>A new item was created</p> <p>Class: SitePage<br /> Name: asdfasdf</p> ----------------- spec/models/admin_notify_spec.rb : require File.dirname(__FILE__) + ''/../spec_helper'' FIXTURES_PATH = File.dirname(__FILE__) + ''/../fixtures'' CHARSET = "utf-8" include ActionMailer::Quoting describe AdminNotify do be...

...llowing IEEE Std 1003.1 (since basename("/")=="" while IEEE requires "/") Help should also explain why and what happens to "\\\\servername", is that dirname, is that basename? Currently we have > dirname(x) [1] "." > basename(x) [1] "\\\\asdfasdf" > file.path(dirname(x), basename(x)) [1] "./\\\\asdfasdf" > version _ platform i386-pc-mingw32 arch i386 os mingw32 system i386, mingw3...

On 03/04/2013 11:07, Renato Golin wrote: > On 1 April 2013 22:05, Bill Wendling <wendling at apple.com > <mailto:wendling at apple.com>> wrote: > > We would like to support ARM again. > > > Hi Bill, > > Glad you asked! ;) [...] > Sylvestre, > > If we do end up creating ARM binaries for the general public, your input > and expertise will

...:8192 -keyout mycert.pem -out mycert.pem openssl s_server -accept 52310 -cert mycert.pem Is it secure? - it could be DOSed' [DenialofService] or could it be attacked in any way? Are there any iptables rule for restricting connections to dyndns names? e.g.: only allow connection from "asdfasdf.dyndns.com" and "asdfasdf2.dyndns.com" and "asdfasdf3.dyndns.com"? How could i restrict the openssl server to only accept traffic from given clients? Please help me "think".. Or are there any "production ready" methods, that can do authentication too...

...ation Science, > Academia Sinica, Taiwan (R.O.C.) > Tel:886-2-2788-3799 #1667 > Homepage: http://people.cs.nctu.edu.tw/~chenwj > > In the following page : http://www.debian.org/ports/kfreebsd-gnu/ There is the following paragraph : " Available Hardware for Debian Developers asdfasdf.debian.net (kfreebsd-amd64) and io.debian.net (kfreebsd-i386) are available to Debian developers for porting work. Please see the machine database for more information about these machines. In general, you will be able to use the two chroot environments: testing and unstable. Note that these system...

Hi, I would like to replace the last tree characters of the values of a certain column in a dataframe. This replacement should only take place if the last three characters correspond to the value "/:/" and they should be replaced with ""(blank) I cannot perform a simple gsub because the characters /:/ might also be present somewhere else in the string values and then they

Sadly, I'm back with another issue. I can do a "system list --all" just fine; however, if I attempt to start the machines, I get back: maas@Bill-MAAS-cc:~$ strace -s 1024 -f -o /tmp/asdfasdf.log virsh -c vbox+ssh://gbadmin@10.20.0.1/system start PXE-client-07 error: Failed to start domain PXE-client-07 error: An error occurred, but the cause is unknown Log files on both client and server are pretty sparse on details of any sort... as, again, is Google. Any ideas? Thanks yet again,...

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

On Wed, Nov 25, 2015 at 04:17:47PM -0500, Ken D'Ambrosio wrote: >Sadly, I'm back with another issue. I can do a "system list --all" >just fine; however, if I attempt to start the machines, I get back: > >maas@Bill-MAAS-cc:~$ strace -s 1024 -f -o /tmp/asdfasdf.log virsh -c >vbox+ssh://gbadmin@10.20.0.1/system start PXE-client-07 >error: Failed to start domain PXE-client-07 >error: An error occurred, but the cause is unknown > This means there was an error (some function returned -1), but the error message was not set. Could you capture the...

Hello, I am new to Asterisk, as of today. Installed on a RH9 box, with no problems. Built with 'make samples' as to get an understanding of how things work. Currently, I am utilizing SJPhone as a SIP client - not interested in shelling out cash for the IP phones, until I know I have a hold on things. I have run into a few problems I was hoping you could help me with : 1. When

...r = * auth_mechanisms = plain login auth_policy_hash_nonce = # hidden, use -P to show it auth_policy_request_attributes = login=%{requested_username} pwhash=%{hashed_password} remote=%{rip} device_id=%{client_id} protocol=%s attrs/local_ip=%{lip} auth_policy_server_api_header = Authorization: Basic asdfasdfasdf auth_policy_server_url = http://wforce.example.com:8084/ auth_verbose = yes auth_verbose_passwords = sha1 default_client_limit = 6000 default_vsz_limit = 2 G dict { acl = mysql:/etc/dovecot/dovecot-dict-shares.conf quotadict = mysql:/etc/dovecot/dovecot-dict-quota.conf } disable_plaintext_a...

Hi fantastic rails core developers. Speaking of version 2.3.5: I find it rather error_prone that values such that "some text" is silently converted to false when stored in a boolean DB field. Among other things it means that assign "some text" to boolean fields on a model will not generate any validation messages (it will silently be converted to false). I think it is like

I'm not sure if this is a bug or a limitation that can be worked around with a setting somewhere, but I have found a problem with cygwin 1.7 while using rsync. I have been using rsync and cygwin v1.5 for quite some time. I recently started testing cygwin v1.7 and I ran into a problem with an apparent limit on the number of files cygwin 1.7 along with rsync can process in a directory. First

[Moved from -current to -stable] ???????? 21 ???????? 2006 16:23, Matthew Dillon ?? ????????: > ? ? You might be doing just writes to the mmap()'d memory, but the system > ? ? doesn't know that. Actually, it does. The program tells it, that I don't care to read, what's currently there, by specifying the PROT_READ flag only. > ? ? The moment you touch any mmap()'d

hello all i''m a newbie on mechanize, but already had some success. But now i''m in a real problem : The following HTML-Code is not parsed corect, not all form element are found. I''can''t change the server-code. How to fix ? HTML-Site ------X-----------------------------------------------------------------------X- <!DOCTYPE HTML PUBLIC "-//W3C//DTD

Hi there, I have some problems stopping my mouse leaving the window. It happens in nearly every game i tired (Stalker, Diablo2. Starcraft) but not in Crimsonland. I have no idea what to do. Of course i tried different settings with winecfg but nothing solved my problem. I'm running Debian/Sid with a dualhead xorg.conf. So if anyone got some ideas, let me know them :)