search for: alphabetfrequ

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

Hiya, I am trying to look at the similarities between a number of sequences, for example i am trying to see how similar "ababbbassdaa" is to "addffggssbbsbbs" I was wondering is the some way for me to see how similar they are in terms of, for example, number of a's, number of b's, how often a and ab are consecutive, how often abab is together etc. Any advice

My goal is simple: calcuate GC content of each sequence in a list of nucleotide sequences. I have figured out how to vectorize, but all my attempts at memoization failed. Can you show me how to properly memoize my function? There is a StackOverflow post on the subject of memoization, but it does not help me: http://stackoverflow.com/questions/7262485/options-for-caching-memoization-hashing-in-r

...m> Subject: Re: [R] Loop avoidance and logical subscripts To: r-help@r-project.org Message-ID: <23745814.post@talk.nabble.com> Content-Type: text/plain; charset=us-ascii Thank you! The script is now adapted to Biostrings and it is really fast! For example, it does:   alph_sequence <- alphabetFrequency(data$sequence, baseOnly=TRUE)   data$GCsequence <- rowSums(alph_sequence[,c("G", "C")]) / rowSums(alph_sequence) in the G+C computation. It also works amazingly fast in substring extraction (substring), reverse complement (reverseComplement sequences), palindromes search...