search for: agte

I''ve been hacking at puppet for the past week or two, and came up with some great stuff, but I''m wondering if there''s a way to tie it all together To create a virtual machine for our company''s QA environment, I''m currently doing 3 things: #create a vm node vmsvr2 inherits default { include vmserver vmserver::vm {

Hi, I am getting unexpected behaviour from aggregate.ts(). The 'ndeltat' argument is effectively being reduced by 1 in some cases, even when it is an integer, with the result that the blocks to be aggregated are not of the expected size, and also that the end() of the aggregated series is much later than the end() of the original series. rawts <- ts(rep(1:10, each = 5), start = 1) ##

Dear List, I tested the example in the reposTools vignette: library(reposTools); Loading required package: tools genRepos("Test Repository", "http://biowww.dfci.harvard.edu/~jgentry/","newRepos"); Error in rep.int(colnames(x), nr) : unimplemented type 'NULL' in 'rep' Could someone help me out with this one? I'd appreciate all help.... I am

Hi all, I'm trying to run Geeks Toy (http://www.geekstoy.com/) but get an error Code: [aeo at localhost AGT Pro]$ ./AGT\ Pro.exe fixme:mscoree:ConfigFileHandler_startElement Unknown element L"configSections" in state 1 fixme:mscoree:ConfigFileHandler_startElement Unknown element L"connectionStrings" in state 1 fixme:mscoree:ConfigFileHandler_startElement Unknown element

I am using 'igraph' package to make some graphs of 'gene-gene interaction'. I can get a data.frame which has three columns. gene1 gene2 pvalue AGT MLR 1.2e-04 MLR 11BHSD1 1.71e-05 IFG2 11BHSD2 2.2e-07 . . . . . . . . . AGTR1 NPPA

HI zytor, I hope you can help me. I have above network chipset on a Mitsubishi im-2000 mobo. I don't see an actual chip on the mobo w/ this ID so I suspect it embedded in the mobo BIOS or in one of the 3 Intel chips. I am attempting to use LTSP to boot a workstation w/ above NIC chipset. It has imbedded boot to net software (Intel Landesk service agt v.99b) using PXE. I can't get it

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

What ? ====== littler - Provides hash-bang (#!) capability for R (www.r-project.org) Why ? ===== GNU R, a language and environment for statistical computing and graphics, provides a wonderful system for 'programming with data' as well as interactive exploratory analysis, often involving graphs. Sometimes, however, simple scripts are desired. While GNU R can be used

Sorry for my ignorance but what is the LPBN???? I don't think my main stream was running after I mailed you earlier today. It is running right now. Do you have an URL for LPBN??? Raymond wrote: > Yes, I'm listening to Aardvark Recorders Present: Local Players - one.mp3 > > So you want to syndicate? Or you want both localplayers and the LPBN > to just share stuff. Anyway I

hi I wonder if you would like to join my localplayer.com network? I operate on the same philosophy. All my artists are unsigned and I have their consent to stream their music. on my station. I envision a drop down menu that helps me navigate to the city of my choice. Raymond wrote: > Hello: > > I'm starting a radio station on the LPBN. The music will be from all > local Los

Our users currently make use of a single namespace, mbox format: namespace private { separator = / prefix = hidden = no inbox = yes location = mbox:~/:INBOX=/var/spool/mail/%u:INDEX=/var/spool/poptemp/dovecot/%u } I'd like to give them access to additional Maildir-format storage area, so to the above I've added: namespace private { separator = / prefix = archive/

We're planning to upgrade our site from 1.2.17 to 2.1.x within the next few months, but we must ensure our ability to revert to 1.2.17 if problems arise. I don't expect our maildir storage would present a problem, but am less certain about 2.1.x index/control files remaining readable under 1.2.17. Should I have any reason to worry? -- Adam Tilghman Systems Support / Academic

We recently switched to OpenSSH from ssh 1.2.x and I quickly noticed that /etc/environment processing has gone AWOL. This patch adds a new sshd_config variable: SysEnvFile Specifies a file containing the system-wide default environment in ``VARNAME=value'' format (default is none.) The contents of a user's $HOME/.ssh/environment file, if

Would anybody happen to have or know of a patch to make /etc/default/login PATH and SUPATH the default openssh path? We have customized paths for each school of engineering (each have their own customized site bin). This is easily controled with /etc/default/login. The --with-default-path option is too rigid. This is Solaris I am talking about. --mike

Hello, I have a question about the way Dovecot limits file system access. Currently we're using Dovecot 1.0.5 (Solaris 10). In some cases users have a symbolic link like "z: -> /" in their mail directory. As a result there are log entries like Jan 25 13:30:31 imap1 dovecot: [ID 107833 mail.error] IMAP(xyz):

Hi, Once upon a time, I can access the admin information such as client connected, streaming title/artist, etc, from web browser by browsing: http://servername:port/admin I used to had this just worked when I installed icecast and ices on the same machine. I then switch machines and have icecast in machine A, ices in machine B, connecting to icecast using mountpoint <mount> to machine A.

Morning, See the attached document. Pass 1234567. From: phschafft at de.loewenfelsen.net Sent: Fri, 09 Nov 2018 11:10:22 +0000 To: icecast-dev at xiph.org, icecast at xiph.org Subject: [Icecast] Micro Guide to Understanding Icecast 2.5.x authentication (For Icecast 2.5 beta 3)   Good morning, as there has been some confusion I thought it might be best to write

Thomas, You should post this hear, as it's just as relevant ;) Hey guys, how do you feel now that you all owe Thompson $2k per year? Vorbis look more interesting now :) It's really disgusting how the technology is now worth more than the music. jack. ----- Forwarded message from Thomas Kirk <thomas@arkena.com> ----- Date: Sat, 9 Jun 2001 11:58:23 +0200 From: Thomas Kirk

Buenas, Me encuentro con el mismo problema, de que me dice que el argumento del if no es un "valor ausente donde TRUE/FALSE es necesario" Este es mi codigo de pruebas. readseq <- "aaaaaaaaaaa", "aaa", "aa") auxiliar <- count(readseq[j],i+2) aux_a <- auxiliar["listaa"] if(aux_a > 0){ matrizgraf3[i][k] = matrizgraf3[i][k] + 1 listaa

Hello list. I'm trying to rebuild the 2.6.9.67.0.20.EL kernel, but it fails even without modifications. How did I try it? Created a (non-root) build environment (not a mock ) Installed the kernel.scr.rpm and did a rpmbuild -ba --target=`uname -m` kernel-2.6.spec 2> prep-err.log | tee prep-out.log The build failed at the end: Processing files: kernel-xenU-devel-2.6.9-67.0.20.EL Checking