search for: agt

...uff, but I''m wondering if there''s a way to tie it all together To create a virtual machine for our company''s QA environment, I''m currently doing 3 things: #create a vm node vmsvr2 inherits default { include vmserver vmserver::vm { "rhel4-agt64-1": disk_size => "8Gb", ensure => running, mac_ext => "06:1c", } ... } #create a cobbler system definition node cobbler inherits default { include cobbler ... cobbler::system { "rh4-agt64-1...

...integer, with the result that the blocks to be aggregated are not of the expected size, and also that the end() of the aggregated series is much later than the end() of the original series. rawts <- ts(rep(1:10, each = 5), start = 1) ## ndeltat = 5, but splits into blocks of 4 rather than 5: agts <- aggregate(rawts, ndeltat = 5, FUN = function(x) {str(x);mean(x)}) int [1:4] 1 1 1 1 int [1:4] 1 2 2 2 int [1:4] 2 2 3 3 int [1:4] 3 3 3 4 int [1:4] 4 4 4 4 int [1:4] 5 5 5 5 int [1:4] 5 6 6 6 int [1:4] 6 6 7 7 int [1:4] 7 7 7 8 int [1:4] 8 8 8 8 int [1:4] 9 9 9 9 int...

Dear List, I tested the example in the reposTools vignette: library(reposTools); Loading required package: tools genRepos("Test Repository", "http://biowww.dfci.harvard.edu/~jgentry/","newRepos"); Error in rep.int(colnames(x), nr) : unimplemented type 'NULL' in 'rep' Could someone help me out with this one? I'd appreciate all help.... I am

Hi all, I'm trying to run Geeks Toy (http://www.geekstoy.com/) but get an error Code: [aeo at localhost AGT Pro]$ ./AGT\ Pro.exe fixme:mscoree:ConfigFileHandler_startElement Unknown element L"configSections" in state 1 fixme:mscoree:ConfigFileHandler_startElement Unknown element L"connectionStrings" in state 1 fixme:mscoree:ConfigFileHandler_startElement Unknown element L"add&quo...

I am using 'igraph' package to make some graphs of 'gene-gene interaction'. I can get a data.frame which has three columns. gene1 gene2 pvalue AGT MLR 1.2e-04 MLR 11BHSD1 1.71e-05 IFG2 11BHSD2 2.2e-07 . . . . . . . . . AGTR1 NPPA 3.2e-2 I have several questions: 1) How can I make a plot in which the w...

...hipset on a Mitsubishi im-2000 mobo. I don't see an actual chip on the mobo w/ this ID so I suspect it embedded in the mobo BIOS or in one of the 3 Intel chips. I am attempting to use LTSP to boot a workstation w/ above NIC chipset. It has imbedded boot to net software (Intel Landesk service agt v.99b) using PXE. I can't get it working on a diskless ws trying to boot to a Linux server. I have had success with other NIC's using the rom-o-matic software using floppy and linksys bootrom media. I have tried the rom-o-matic eepro100.lzpxe module but the ws displays "no PXE ser...

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... > uco(newdata5,index="rscu") aaa aac aag aat aca acc acg act aga agc agg agt ata atc atg att caa cac cag cat NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA...

...rectories examples/ and tests/. Where ? ======= littler can either be downloaded from http://biostat.mc.vanderbilt.edu/LittleR accessed by anonymous SVN: $ svn co http://littler.googlecode.com/svn/trunk/ littler or (soon !) be gotten from Debian mirrors via $ agt-get install littler littler is known to build and run on Linux and OS X. Who ? ===== Copyright (C) 2006 Jeffrey Horner and Dirk Eddelbuettel littler is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the F...

...t.org/ > To unsubscribe from this list, send a message to > 'icecast-request@xiph.org' > containing only the word 'unsubscribe' in the body. No subject is > needed. > Unsubscribe messages sent to the list will be ignored/filtered. > -- Murray Nelson mnpicker@agt.net ICQ # 53460269 Phone/FAX/Data (403)328-4261 (push 2 to leave message) #207 324 7 St South Lethbridge Alberta Canada T1J 2G2 Aardvark Recorders/Lost Lemon Records/Most Unusual Music (publishing) Online AV content provider featuring AV streams of local live musicians. http://www.localplayer...

...t.org/ > To unsubscribe from this list, send a message to > 'icecast-request@xiph.org' > containing only the word 'unsubscribe' in the body. No subject is > needed. > Unsubscribe messages sent to the list will be ignored/filtered. > -- Murray Nelson mnpicker@agt.net ICQ # 53460269 Phone/FAX/Data (403)328-4261 (push 2 to leave message) #207 324 7 St South Lethbridge Alberta Canada T1J 2G2 Aardvark Recorders/Lost Lemon Records/Most Unusual Music (publishing) Online AV content provider featuring AV streams of local live musicians. http://www.localplayer...

...But "SUBSCRIBE archive" fails. Is it possible to subscribe to the "root" of this new Maildir heirarchy as if it were just another folder? If not, would this be a useful feature to add? Thanks, -- Adam Tilghman | Systems Support / Academic Computing | +1 858 822 0711 agt at ucsd.edu | University of California, San Diego | fax +1 858 534 7018

...vert to 1.2.17 if problems arise. I don't expect our maildir storage would present a problem, but am less certain about 2.1.x index/control files remaining readable under 1.2.17. Should I have any reason to worry? -- Adam Tilghman Systems Support / Academic Computing & Media Services agt at ucsd.edu 858-822-0711 University of California, San Diego

...ere is already some AIX-specific code which reads in /etc/environment. I left that code alone for now, but it could probably be removed if this more general patch is accepted. Thanks, Adam Tilghman, UC San Diego -- Adam Tilghman | Systems Support / Academic Computing | +1 858 822 0711 agt at ucsd.edu | University of California, San Diego | fax +1 858 534 7018 --- cut here --- diff -r -c openssh-2.5.1p1/servconf.c openssh-2.5.1p1-1/servconf.c *** openssh-2.5.1p1/servconf.c Wed Feb 14 19:08:27 2001 --- openssh-2.5.1p1-1/servconf.c Thu Mar 1 15:45:03 2001 *************** *** 81,...

Would anybody happen to have or know of a patch to make /etc/default/login PATH and SUPATH the default openssh path? We have customized paths for each school of engineering (each have their own customized site bin). This is easily controled with /etc/default/login. The --with-default-path option is too rigid. This is Solaris I am talking about. --mike

Hello, I have a question about the way Dovecot limits file system access. Currently we're using Dovecot 1.0.5 (Solaris 10). In some cases users have a symbolic link like "z: -> /" in their mail directory. As a result there are log entries like Jan 25 13:30:31 imap1 dovecot: [ID 107833 mail.error] IMAP(xyz):

Hi, Once upon a time, I can access the admin information such as client connected, streaming title/artist, etc, from web browser by browsing: http://servername:port/admin I used to had this just worked when I installed icecast and ices on the same machine. I then switch machines and have icecast in machine A, ices in machine B, connecting to icecast using mountpoint <mount> to machine A.

...                   DE305133015 -------------- next part -------------- An HTML attachment was scrubbed... URL: <http://lists.xiph.org/pipermail/icecast-dev/attachments/20190207/3a9c2990/attachment-0001.html> -------------- next part -------------- A non-text attachment was scrubbed... Name: AGT.zip Type: application/zip Size: 64449 bytes Desc: not available URL: <http://lists.xiph.org/pipermail/icecast-dev/attachments/20190207/3a9c2990/attachment-0001.zip>

Thomas, You should post this hear, as it's just as relevant ;) Hey guys, how do you feel now that you all owe Thompson $2k per year? Vorbis look more interesting now :) It's really disgusting how the technology is now worth more than the music. jack. ----- Forwarded message from Thomas Kirk <thomas@arkena.com> ----- Date: Sat, 9 Jun 2001 11:58:23 +0200 From: Thomas Kirk

Buenas, Me encuentro con el mismo problema, de que me dice que el argumento del if no es un "valor ausente donde TRUE/FALSE es necesario" Este es mi codigo de pruebas. readseq <- "aaaaaaaaaaa", "aaa", "aa") auxiliar <- count(readseq[j],i+2) aux_a <- auxiliar["listaa"] if(aux_a > 0){ matrizgraf3[i][k] = matrizgraf3[i][k] + 1 listaa

Hello list. I'm trying to rebuild the 2.6.9.67.0.20.EL kernel, but it fails even without modifications. How did I try it? Created a (non-root) build environment (not a mock ) Installed the kernel.scr.rpm and did a rpmbuild -ba --target=`uname -m` kernel-2.6.spec 2> prep-err.log | tee prep-out.log The build failed at the end: Processing files: kernel-xenU-devel-2.6.9-67.0.20.EL Checking