search for: aats

Hi all, How can I convert factor like this: > str(repo) 'data.frame': 1000 obs. of 1 variable: $ AAA: Factor w/ 1000 levels "AAT","AAC",..: 1 2 3 4 5 6 7 8 9 10 ... > print(repo) AAA 1 AAA 2 AAT 3 AAC ... into to simple vector > str(new_repo) chr [1:100] "AAA" "AAT" "AAC" "AAG" "ATA" "ATT"...

...-0.25, -0.11, 0.02, 0.15, 0.27, 0.39, 0.5, 0.6, 0.7, 0.79, 0.87, 0.96, 1.04, 1.11, 1.18, 1.24, 1.28, 1.31, 1.31, 1.29, 1.25, 1.18, 1.08, 0.96, 0.8, 0.62, 0.42, 0.2, -0.03, -0.27)), .Names = "X.0.85", class = "data.frame", row.names = c(NA, -240L))) library(wmtsa) library(fields) aats <- ts (aa, deltat =1/30, start = 0.0) aa.cwt <- wavCWT(aats) aa.tree <- wavCWTTree (aa.cwt) aa.peak <- wavCWTPeaks(aa.tree) sorry I didn't realize that only the mexican hat wavelet could be used for the peak function. This should work fine. and Use the tim.colors argument in the...

Dear all, I tried to find index in repo given a query with this: > repo <- c("AAA", "AAT", "AAC", "AAG", "ATA", "ATT") > qr <- c("AAC", "ATT", "ATT") > which(repo%in%qr) [1] 3 6 Note that the query contain repeating elements, yet the output of which only returns unique. How can I make it

Full_Name: Maura Monville Version: 2.8 OS: Mac OS/X 10.5 Submission from: (NULL) (87.4.122.234) Here is the code that causes wavCWTPeaks error aats <- create.signalSeries(aa, pos=list(from=0.0, by=0.033)) aa.cwt <- wavCWT(aats) x11 (width=10,height=12) plot (aats,main=paste(insig," Cycle: ",j,sep="")) aa.maxtree <- wavCWTTree (aa.cwt, type="maxima") aa.mintree <- wavCWTTree (aa.cwt, ty...

Dear Steve, I'll post your question also to the R-help mailing list since I think this can help to other RArcInfo users. As I mentioned in the last release of the package, I have a tutorial nearly finished. I hope to release it in the next days. > I have downloaded an .e00 file of 2000 Census Tracts for the southern US > State of Georgia, and I'm wondering which steps I need to go

...0.158521870 0.112655403 0.066350293 0.019647991 -0.027409468 [236] -0.074779520 -0.122419124 -0.170284817 -0.218332766 -0.266518818 [241] -0.314798550 I convert it into a time series and then I get the CWT coefficients. Then I build the tree that exhibits only 3 branches (see attached plot) aats <- ts (aa, deltat =1/30, start = 0.0) aa.cwt <- wavCWT(aats) aa.tree <- wavCWTTree (aa.cwt) I can get the data for each of the 3 branches: > aa.tree[[1]] $itime [1] 135 135 134 133 132 130 128 126 123 122 122 122 122 123 126 $iscale [1] 1 2 3 4...

I am new to R and am trying to specify a model for mixed model analysis. When I run the following model I get an error: AAT<- lmer(Y ~ S + A + (1|S:A/H), data=AT, REML=True) The error looks like this: Error in Spar_loc:`:` : NA/NaN argument In addition: Warning messages: 1: In model.matrix.default(mt, mf, contrasts) : variable 'Spar_loc' converted to a factor 2: In Spar_loc:`:` :

Hello R users, A beginners question which I could not find the answer to in earler posts. My thought process: Here "z" is a 119 x 15 data matrix Step 1: start at column one, bind every column with column 1 Step2: use the new matrix, "test", in the fitCopula package Step3: store each result in myfit, bind each result to "answer" Step4: return "answer"

Greetings, Does anyone know if there is a cost effective way to interface an older AT&T Spirit system into Asterisk. I'm only interested in A) being able to offer voicemail and B) possibly an AAT to callers. I've thought about just stringing the FXO cards into the line1/2 slots that go into the Spirit system... asterisk would pickup if no one answered the Spirit phones.... however....

Dear all, I have a repository file (let's call it repo.txt) that contain two columns like this: # tag value AAA 0.2 AAT 0.3 AAC 0.02 AAG 0.02 ATA 0.3 ATT 0.7 Given another query vector > qr <- c("AAC", "ATT") I would like to find the corresponding value for each query above, yielding: 0.02 0.7 However, I want to avoid slurping whole repo.txt

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Dear R Helpers, I have a list that contains a number of objects, each of them financial statement data from quantmod (although I don't think that knowledge of quantmod is necessary to help with this problem). > str(listfinobj) chr [1:4815] "A.f" "AA.f" "AACC.f" "AAME.f" "AAN.f" "AAON.f" "AAP.f" "AAPL.f"

I Don't speak the language it is in, but is this spam? -----Original Message----- From: samba-admin@lists.samba.org [mailto:samba-admin@lists.samba.org] On Behalf Of SAGLAM SiGORTA Sent: Wednesday, November 14, 2001 10:40 PM To: samba@samba.org Subject: BASA GELEN CEKiLiR DEMEYiN.. Importance: High SA?LAM S?GORTA ARACILIK H?ZMETLER? Merhabalar, Size ?ncelikle firmam?z? tan?tarak

Hello everyone, Here is the setup. z is a 119 x 15 matrix, m_index is a 119 x 5 matrix What I am trying to do is return the results from fitCopula by sequentially binding all 15 columns of z to the first column of m_index, (cbind(z[,1],m_index[,1]),(cbind(z[,2],m_index[,1]), etc. Unfortunately, my code below only binds z[,1] and m_index[,1] and return the same result 14 times. Any ideas on

which ir is the * channel? I have decleared 1 peer one in veracruz: [aullox_gdl] type=peer username=aullox_gdl host=200.67.99.127 and aat gdl I have: exten => 200,Dial(IAX/aullox_gdl@200.64.35.58/200@aullox) 200.64.35.58 is my ip 200 is tehe xtension and aull is the context and at veracruz i have: [aullox] exten => 200,1,Wait,2 exten => 200,2,Playback(transfer,skip) ;

Hi all, I''m using Windows Xp, Mysql 5, Webrick, Rails 1.0 I''ve 3 tables which have HABTM relationship. My tables names are all set to uncountble. Name of tabels are anabilimdali (includes department info id name etc.), ogretimuye (personel information like id , name , dept. ) yayin (document information), and for relationships yayin_anabilimdali , yayin_ogretimuye . The

Hi all, I am interested in calculating and displaying the distributions of pairwise comparisons between DNA sequences in populations. The comparisons are the number of nucleotide sites that differ between the two sequences (mismatches). My sequences are stored in a vector of strings. There is an additional vector of the same length that provides the indices to the DNA sequences. Finally, I

Buenas, Me encuentro con el mismo problema, de que me dice que el argumento del if no es un "valor ausente donde TRUE/FALSE es necesario" Este es mi codigo de pruebas. readseq <- "aaaaaaaaaaa", "aaa", "aa") auxiliar <- count(readseq[j],i+2) aux_a <- auxiliar["listaa"] if(aux_a > 0){ matrizgraf3[i][k] = matrizgraf3[i][k] + 1 listaa