search for: aat

Hi all, How can I convert factor like this: > str(repo) 'data.frame': 1000 obs. of 1 variable: $ AAA: Factor w/ 1000 levels "AAT","AAC",..: 1 2 3 4 5 6 7 8 9 10 ... > print(repo) AAA 1 AAA 2 AAT 3 AAC ... into to simple vector > str(new_repo) chr [1:100] "AAA" "AAT" "AAC" "AAG" "ATA" "ATT"... > print(new_repo) [1] "AAA" "...

...-0.25, -0.11, 0.02, 0.15, 0.27, 0.39, 0.5, 0.6, 0.7, 0.79, 0.87, 0.96, 1.04, 1.11, 1.18, 1.24, 1.28, 1.31, 1.31, 1.29, 1.25, 1.18, 1.08, 0.96, 0.8, 0.62, 0.42, 0.2, -0.03, -0.27)), .Names = "X.0.85", class = "data.frame", row.names = c(NA, -240L))) library(wmtsa) library(fields) aats <- ts (aa, deltat =1/30, start = 0.0) aa.cwt <- wavCWT(aats) aa.tree <- wavCWTTree (aa.cwt) aa.peak <- wavCWTPeaks(aa.tree) sorry I didn't realize that only the mexican hat wavelet could be used for the peak function. This should work fine. and Use the tim.colors argument in th...

Dear all, I tried to find index in repo given a query with this: > repo <- c("AAA", "AAT", "AAC", "AAG", "ATA", "ATT") > qr <- c("AAC", "ATT", "ATT") > which(repo%in%qr) [1] 3 6 Note that the query contain repeating elements, yet the output of which only returns unique. How can I make it returning [...

Full_Name: Maura Monville Version: 2.8 OS: Mac OS/X 10.5 Submission from: (NULL) (87.4.122.234) Here is the code that causes wavCWTPeaks error aats <- create.signalSeries(aa, pos=list(from=0.0, by=0.033)) aa.cwt <- wavCWT(aats) x11 (width=10,height=12) plot (aats,main=paste(insig," Cycle: ",j,sep="")) aa.maxtree <- wavCWTTree (aa.cwt, type="maxima") aa.mintree <- wavCWTTree (aa.cwt, t...

...:1625 Number of LABELS:1624 Number of POLYGONS:1625 Number of TOLERANCES:10 > attach(d) > plotpal(arc, pal) > newarc<-thinlines(arc,.05) > plotpal(newarc, pal) > get.tablenames("info/") TableName InfoFile NFields RecSize NRecords External 1 TR13.AAT ARC0001 1 38 16723 TRUE 2 TR13.BND ARC0002 1 32 1 FALSE 3 TR13.PAT ARC0003 1 178 1625 FALSE 4 TR13.TIC ARC0004 1 20 4 FALS...

...0.158521870 0.112655403 0.066350293 0.019647991 -0.027409468 [236] -0.074779520 -0.122419124 -0.170284817 -0.218332766 -0.266518818 [241] -0.314798550 I convert it into a time series and then I get the CWT coefficients. Then I build the tree that exhibits only 3 branches (see attached plot) aats <- ts (aa, deltat =1/30, start = 0.0) aa.cwt <- wavCWT(aats) aa.tree <- wavCWTTree (aa.cwt) I can get the data for each of the 3 branches: > aa.tree[[1]] $itime [1] 135 135 134 133 132 130 128 126 123 122 122 122 122 123 126 $iscale [1] 1 2 3 4...

I am new to R and am trying to specify a model for mixed model analysis. When I run the following model I get an error: AAT<- lmer(Y ~ S + A + (1|S:A/H), data=AT, REML=True) The error looks like this: Error in Spar_loc:`:` : NA/NaN argument In addition: Warning messages: 1: In model.matrix.default(mt, mf, contrasts) : variable 'Spar_loc' converted to a factor 2: In Spar_loc:`:` : numerical expression ha...

...cbind(z[,1],z[,i]) myfit[i] <- fitCopula(test,my.cop, start=0.3) } answer <- cbind(myfit[i]) return(answer) } Errors received: Error: object "test" not found Could my syntax be incorrect, or is it a deeper faulty logic error. Thank you for your help, it is much appreciated. aat -- View this message in context: http://www.nabble.com/for-loop-problem-tf3047849.html#a8472217 Sent from the R help mailing list archive at Nabble.com.

Greetings, Does anyone know if there is a cost effective way to interface an older AT&T Spirit system into Asterisk. I'm only interested in A) being able to offer voicemail and B) possibly an AAT to callers. I've thought about just stringing the FXO cards into the line1/2 slots that go into the Spirit system... asterisk would pickup if no one answered the Spirit phones.... however.... Is there anyway anyone knows of to either A) allow transfer between the two systems or... (I have 3 a...

Dear all, I have a repository file (let's call it repo.txt) that contain two columns like this: # tag value AAA 0.2 AAT 0.3 AAC 0.02 AAG 0.02 ATA 0.3 ATT 0.7 Given another query vector > qr <- c("AAC", "ATT") I would like to find the corresponding value for each query above, yielding: 0.02 0.7 However, I want to avoid slurping whole repo.txt into an object (e.g. hash). Is t...

...lysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... > uco(newdata5,index="rscu") aaa aac aag aat aca acc acg act aga agc agg agt ata atc atg att caa cac cag cat NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA cca ccc ccg cct cga cgc cgg cgt cta ctc ctg ctt gaa gac gag gat gca gcc gcg gct NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA...

...ta from quantmod (although I don't think that knowledge of quantmod is necessary to help with this problem). > str(listfinobj) chr [1:4815] "A.f" "AA.f" "AACC.f" "AAME.f" "AAN.f" "AAON.f" "AAP.f" "AAPL.f" "AAT.f" "AATI.f" "AAU.f" ... I can easily pick out the 3rd object in this list. > listfinobj[[3]] [1] "AACC.f" Each of the .f objects has a mildly complicated structure (partial results shown below). > str(AACC.f) List of 3 $ IS:List of 2 ..$ Q: num [1:49, 1...

...s?zl?k 3.?ah?slara Kar?? Mesuliyet Cam K?r?lmas? ?? Veren Mali Mesuliyet Ferdi Kaza . Kasko Sigortalar? Kasko Paket Poli?esi (Hususi Oto, Minib?s, Kamyon vs.) Mecburi Trafik Poli?esi . M?hendislik Sigortalar? Makina K?r?lmas? Poli?esi Elektronik Cihaz Poli?esi ?n?aat Poli?eleri . Nakliyat ve Tekne Sigortalar? ve di?er ?zellik arzeden sigorta konular?nda; ?nvan?m?z?n ve ad?m?z?n verdi?i g?venle siz m??terilerimize kar??, hizmet sekt?r? olan sigortac?l???n t?m gereklerini sonuna kadar yerine getirmeyi taahh?t ediyoruz. Sigorta sekt?r?nde bilfiil 11 y?l gibi bir...

...getting the same result 14 times, shouldn't it be 15 since there are 15 columns in z? my.cop <- normalCopula(param = 0.5, dim = 2) answer <- apply(z[,-1], 2, function(m_index[,1],my.cop) fitCopula(cbind(z[,-1], m_index[,1]), my.cop, start=0.3), my.cop = my.cop) Thanks for help. Adam (aat) -- View this message in context: http://www.nabble.com/traverse-through-many-columns-of-a-matrix-in-a-function-tf3152747.html#a8742152 Sent from the R help mailing list archive at Nabble.com.

which ir is the * channel? I have decleared 1 peer one in veracruz: [aullox_gdl] type=peer username=aullox_gdl host=200.67.99.127 and aat gdl I have: exten => 200,Dial(IAX/aullox_gdl@200.64.35.58/200@aullox) 200.64.35.58 is my ip 200 is tehe xtension and aull is the context and at veracruz i have: [aullox] exten => 200,1,Wait,2 exten => 200,2,Playback(transfer,skip) ; "Please hold while..." exten => 2...

...Parameters: {"commit"=>"Create", "ogretimuye"=>{"ogretimuye.id"=>["161"]}, "yayin"=>{"ad"=>"888888888"}, "action"=>"create", "controller"=>"yayin", "AAT\375p"=>"0"} [4;36;1mAnabilimdali Load (0.000000) [0;1mSELECT * FROM anabilimdali [4;35;1mOgretimuye Load (0.079000) SELECT * FROM ogretimuye [4;36;1mYayin Columns (0.015000) [0;1mSHOW FIELDS FROM yayin [4;35;1mSQL (0.000000) BEGIN [4;36;1mSQL (0.000000) [0...

...ngs. There is an additional vector of the same length that provides the indices to the DNA sequences. Finally, I have output from table() that gives the distribution of indices in the population. It looks something like this: seqindex 1,2,3,4,5 sequences "ATG","ATC","AAT","CTT","GTC" table() output of seqindex frequencies: 1 2 3 4 5 6 10 5 1 7 The sequences are usually around 100 characters long (rather than 3) and there can be several hundred different unique sequences and the freqencies of sequence indices may tot...

Buenas, Me encuentro con el mismo problema, de que me dice que el argumento del if no es un "valor ausente donde TRUE/FALSE es necesario" Este es mi codigo de pruebas. readseq <- "aaaaaaaaaaa", "aaa", "aa") auxiliar <- count(readseq[j],i+2) aux_a <- auxiliar["listaa"] if(aux_a > 0){ matrizgraf3[i][k] = matrizgraf3[i][k] + 1 listaa