search for: aage

I set up a samba 3.0.2 server as member server in a NT4 Domain. Winbind works great and I can "use" the NT Domain users for all I need. At the moment I'm testing different shares with their permissions. The Samba will also be our printserver, so I set up also cups and added the printers to samba with cupsaddsmb - Great tool! . Users could connect and all worked fine. After a reboot

Hallo! after migrating the pdc from nt to samba+ldap my member fileserver doesn't see the groups anymore. I set it up with nss as shown in: http://samba.org/samba/docs/man/Samba-Guide/unixclients.html#ch9-sdmnss getent passwd + group show all user and groups correctly wbinfo -u shows all users correctly, but wbinfo -g show only 2 builtin accounts. I tried without nss only with winbind

...clearer. My dataset (matrix) has sample events by rows (U1,U2,U3) and detected species by columns. U<-read.table("C:\\Documents \\tre_usc.txt",header=T,row.names=1,sep="\t",dec = ",") U # global matrix with 3 samples SPECIE Aadi Aagl Apap Aage Bdia Beup Crub Carc Cpam U1 0 0 0 0 7 0 5 0 1 U2 0 0 0 0 4 2 1 0 0 U3 0 0 0 0...

Dear all, I tried to find index in repo given a query with this: > repo <- c("AAA", "AAT", "AAC", "AAG", "ATA", "ATT") > qr <- c("AAC", "ATT", "ATT") > which(repo%in%qr) [1] 3 6 Note that the query contain repeating elements, yet the output of which only returns unique. How can I make it

Hi all, How can I convert factor like this: > str(repo) 'data.frame': 1000 obs. of 1 variable: $ AAA: Factor w/ 1000 levels "AAT","AAC",..: 1 2 3 4 5 6 7 8 9 10 ... > print(repo) AAA 1 AAA 2 AAT 3 AAC ... into to simple vector > str(new_repo) chr [1:100] "AAA" "AAT" "AAC" "AAG" "ATA" "ATT"...

Hi, I'm settin up a member Server in a samba domain. (both 3.0.24) getent passwd/group shows all user and groups wbinfo -u/g shows user and groups net groupmap list shows all groups correctly Here's the testparm output: Server role: ROLE_DOMAIN_MEMBER [global] workgroup = AAG server string = FILES (%v) security = DOMAIN password server = 192.168.100.72

hi, I have 2 files example 1 and example 2 and would like to know what is in example2 and not in example1 (attached) V1 contain data which could be in duplicated which I am using as identifiers I used setdiff(example2$V1,example1$V1) to find the identifiers which are specific to example2: [1] "rs2276598" "rs17253672" I am looking for a way to get an output with all

Dear all, I have a repository file (let's call it repo.txt) that contain two columns like this: # tag value AAA 0.2 AAT 0.3 AAC 0.02 AAG 0.02 ATA 0.3 ATT 0.7 Given another query vector > qr <- c("AAC", "ATT") I would like to find the corresponding value for each query above, yielding: 0.02 0.7 However, I want to avoid slurping whole repo.txt

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

...commercial VOIP test products can I turn to in order to objectively evaluate your CODEC; in order to analyze audio streams for MOS scores and performance parameters? - ATT ============================================================================================================================= Aage Tengesdal Manager, Network Engineering and Application Integration North America Infrastructure Team McDonald's Corporation 630.623.2608 (O) 2111 McDonald's Drive, Plaza Suite 7W 630.623.3211 (F) Oak Brook, IL 60523 630.730.8175 (M) a...

Hello LLVMdev, I’m using LLVM to do static analysis exclusively (without any code generation). To implement this analysis, I’m using multiple address spaces to disambiguate the purpose of the pointed memory. Since address spaces never alias in my model, I set on to implement an alias analysis pass that would exactly provide this information, as I’m seeing a couple of otherwise dead store that

Hallo, I have an old samba-cups printserver (debian woody), connected to the domain through winbind,?that I must replace now. I installed a new samba-cups server on a sarge machine. Windbind works, I can get all users and groups. I copied the generic windows postscript driver files as in cupsaddsmb-manpage described to /usr/share/cups/drivers (tried also adobe drivers) Also tried the same

We are happy to present the agenda for the Asterisk conference at the Atlanta Marriot Century Center - Astricon 2004. Previously, you could only find the tutorials agenda on the web site, but now we've added information on the conference day as well. The Astricon Conference starts with one day of in-depth tutorials on many levels, both for the new Asterisk user and for the one that considers

Dear all, I have ended up in a situation where CentOS 5.0 does not work for me - is it feasible to downgrade from 5.0 to 4.6 while the servers are up, or would the most sensible option be to just reinstall from scratch? Thanks in advance + best regards Jan

I have a machine with a running samba 3.0.24 with winbind. After an update to 3.0.25c I couldn't connect from win clients. So I first tried to rejoin and got some errors about trust account problems - sorry didn't save them. Then I deletet the account the tried a fresh join from the machine: net rpc join -Uaga -Waag -Serde Password: [2007/08/23 11:13:39, 0]

...tips on where to start looking for clues as to what is going on? I am completely open to this being due to configuration errors, but at the same time, I can''t remember anything trying to be "clever" in this install. Thanks in advance for any assistance! Best regards Jan -- Jan-Aage Frydenbø-Bruvoll Principal architech architechs ltd _______________________________________________ Xen-users mailing list Xen-users@lists.xensource.com http://lists.xensource.com/xen-users

Hi list, I am still a newbie and struggling with tweaking the dial plan to my requirements. I have tried googling for this specific problem, and apologies if I have overlooked the obvious answer already. If you could please be so kind as to point me in the right direction, that would be most appreciated. What I am trying to do, is get rid of the initial "+" in phone numbers coming in

Dear All I would really appreciate some help with a script which a colleague wrote for me, but I am having problems running (and have not been able to contact my colleague). The script is designed to compare the area of suitable habitat in binary projections of a large number of species current and future distributions, and create an excel file detailing the total area suitable in the

Buenas, Me encuentro con el mismo problema, de que me dice que el argumento del if no es un "valor ausente donde TRUE/FALSE es necesario" Este es mi codigo de pruebas. readseq <- "aaaaaaaaaaa", "aaa", "aa") auxiliar <- count(readseq[j],i+2) aux_a <- auxiliar["listaa"] if(aux_a > 0){ matrizgraf3[i][k] = matrizgraf3[i][k] + 1 listaa

Signed-off-by: Scott Seago <sseago at redhat.com> --- AUTHORS | 17 ++++++ README | 10 +++ conf/ovirt-agent | 12 ++++ conf/ovirt-db-omatic | 12 ++++ conf/ovirt-host-browser | 12 ++++