search for: aag

...again. Did I missunderstood completely the function of winbind or is there something wrong here? Here a little more infos to the system Let me know if other infos are needed. Tia Angela woody 3 with actual sec. patches samba 3.0.2 from backports here's the smb.conf [global] workgroup = AAG netbios name = S10amba security = domain encrypt passwords = yes password server = 192.168.100.31 wins server = 192.168.100.30 host msdfs = yes ################################# #template shell = /bin/false #template homedir = /work/home/%u max mux = 200 max open files = 8000 ################...

...#39;m very greateful for any hints. thanks angela ******************** here my smb.conf ******************** [global] # Server Definition server string = %h (%v) domain logons = no domain master = no local master = no preferred master = no timeserver = no # Domaenen Zugehoerigkeit workgroup = AAG security = domain password server = 192.168.100.72 # Namensaufloesung name resolve order = host wins bcast # Erlaubte Authentifizierungsprotokolle map archive = yes map hidden = no map readonly = yes map system = no map to guest = never delete readonly = yes preserve case = yes # Nach 15 Min....

...ake my problem clearer. My dataset (matrix) has sample events by rows (U1,U2,U3) and detected species by columns. U<-read.table("C:\\Documents \\tre_usc.txt",header=T,row.names=1,sep="\t",dec = ",") U # global matrix with 3 samples SPECIE Aadi Aagl Apap Aage Bdia Beup Crub Carc Cpam U1 0 0 0 0 7 0 5 0 1 U2 0 0 0 0 4 2 1 0 0 U3 0 0...

Dear all, I tried to find index in repo given a query with this: > repo <- c("AAA", "AAT", "AAC", "AAG", "ATA", "ATT") > qr <- c("AAC", "ATT", "ATT") > which(repo%in%qr) [1] 3 6 Note that the query contain repeating elements, yet the output of which only returns unique. How can I make it returning [1] 3 6 6 instead? - Gundala Vis...

...repo) 'data.frame': 1000 obs. of 1 variable: $ AAA: Factor w/ 1000 levels "AAT","AAC",..: 1 2 3 4 5 6 7 8 9 10 ... > print(repo) AAA 1 AAA 2 AAT 3 AAC ... into to simple vector > str(new_repo) chr [1:100] "AAA" "AAT" "AAC" "AAG" "ATA" "ATT"... > print(new_repo) [1] "AAA" "AAT" "AAC" "AAG" "ATA" "ATT"... I tried as.vector(), but it remains the same factor. - Gundala Viswanath Jakarta - Indonesia

Hi, I'm settin up a member Server in a samba domain. (both 3.0.24) getent passwd/group shows all user and groups wbinfo -u/g shows user and groups net groupmap list shows all groups correctly Here's the testparm output: Server role: ROLE_DOMAIN_MEMBER [global] workgroup = AAG server string = FILES (%v) security = DOMAIN password server = 192.168.100.72 passdb backend = ldapsam:ldap://192.168.100.72/ log level = 10 log file = /var/log/samba/%m.log name resolve order = host wins bcast deadtime = 15 ke...

...13 1 SYNONYMOUS_CODING 704 705 235 V gtA/gtG rs4685 2 SYNONYMOUS_CODING 3749 3657 1219 V gtA/gtG rs4685 3 SYNONYMOUS_CODING 2723 2631 877 G ggT/ggC rs788018 4 SYNONYMOUS_CODING 515 423 141 K aaA/aaG rs788023 5 SYNONYMOUS_CODING 365 27 9 P ccC/ccT rs41284843 6 SYNONYMOUS_CODING 264 27 9 P ccC/ccT rs41284843 7 SYNONYMOUS_CODING 365 27 9 P ccC/ccT rs41284843 8 NMD_TRANSCRIPT,SYNONYMOUS_CODING 264 27...

Dear all, I have a repository file (let's call it repo.txt) that contain two columns like this: # tag value AAA 0.2 AAT 0.3 AAC 0.02 AAG 0.02 ATA 0.3 ATT 0.7 Given another query vector > qr <- c("AAC", "ATT") I would like to find the corresponding value for each query above, yielding: 0.02 0.7 However, I want to avoid slurping whole repo.txt into an object (e.g. hash). Is there any ways to do th...

...analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... > uco(newdata5,index="rscu") aaa aac aag aat aca acc acg act aga agc agg agt ata atc atg att caa cac cag cat NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA cca ccc ccg cct cga cgc cgg cgt cta ctc ctg ctt gaa gac gag gat gca gcc gcg gct NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA...

...commercial VOIP test products can I turn to in order to objectively evaluate your CODEC; in order to analyze audio streams for MOS scores and performance parameters? - ATT ============================================================================================================================= Aage Tengesdal Manager, Network Engineering and Application Integration North America Infrastructure Team McDonald's Corporation 630.623.2608 (O) 2111 McDonald's Drive, Plaza Suite 7W 630.623.3211 (F) Oak Brook, IL 60523 630.730.8175 (M)...

...> > // Register this pass... > char AddressSpaceAliasAnalysis::ID = 0; > > static RegisterPass<AddressSpaceAliasAnalysis> aasa("asaa", "NoAlias for pointers in different address spaces", false, true); > static RegisterAnalysisGroup<AliasAnalysis> aag(aasa); > > FunctionPass* createAddressSpaceAliasAnalysisPass() { > return new AddressSpaceAliasAnalysis(); > } I made it a FunctionPass instead of an ImmutablePass because InitializeAliasAnalysis now needs a DataLayout argument, and I wasn’t sure how to get that one from an Immutabl...

...2 21:55 cupsps6.dll -r-xr-xr-x 1 admin lpadmin 13672 Jan 2 21:55 cupsui6.dll It would be really great if someone could point me to the problem or error I don't see! tia angela I attach a log from cupsaddsmb with debug level 5 and here's testparm output: [global] workgroup = AAG server string = Samba %v security = DOMAIN password server = 192.168.100.30 log level = 5 winbind:2 passdb:5 printdrivers:5 tdb:5 syslog = 0 log file = /var/log/samba/log.%m printcap name = cups preferred master = No domain mas...

...reviously, you could only find the tutorials agenda on the web site, but now we've added information on the conference day as well. The Astricon Conference starts with one day of in-depth tutorials on many levels, both for the new Asterisk user and for the one that considers him- or herself an AAG - Advanced Asterisk Guru (tm). On the evening, we will open the Astricon Exhibition with a reception. You will find many companies with products and services related to Asterisk on the exhibition floor. *** Please note that we've added new tutorials to the agenda. * http://www.astricon.net/co...

Dear all, I have ended up in a situation where CentOS 5.0 does not work for me - is it feasible to downgrade from 5.0 to 4.6 while the servers are up, or would the most sensible option be to just reinstall from scratch? Thanks in advance + best regards Jan

...unning samba 3.0.24 with winbind. After an update to 3.0.25c I couldn't connect from win clients. So I first tried to rejoin and got some errors about trust account problems - sorry didn't save them. Then I deletet the account the tried a fresh join from the machine: net rpc join -Uaga -Waag -Serde Password: [2007/08/23 11:13:39, 0] ./source/utils/net_rpc_join.c:net_rpc_join_newstyle(304) error setting trust account password: NT code 0x1c010002 Unable to join domain AAG. When going back to 3.0.24 there is no problem with joining. I found some similar posting when googling, but no...

...tips on where to start looking for clues as to what is going on? I am completely open to this being due to configuration errors, but at the same time, I can''t remember anything trying to be "clever" in this install. Thanks in advance for any assistance! Best regards Jan -- Jan-Aage Frydenbø-Bruvoll Principal architech architechs ltd _______________________________________________ Xen-users mailing list Xen-users@lists.xensource.com http://lists.xensource.com/xen-users

Hi list, I am still a newbie and struggling with tweaking the dial plan to my requirements. I have tried googling for this specific problem, and apologies if I have overlooked the obvious answer already. If you could please be so kind as to point me in the right direction, that would be most appreciated. What I am trying to do, is get rid of the initial "+" in phone numbers coming in

....org; skopp at esri.com Subject: Re: [R-sig-Geo] R / ArcGIS On Fri, 17 Feb 2012, Michael Denslow wrote: > On Fri, Feb 17, 2012 at 2:15 AM, Edzer Pebesma > <edzer.pebesma at uni-muenster.de> wrote: >> Hi, >> >> I might succeed meeting with some ESRI / ArcGIS folks at AAG next week; >> I'm in touch with them in particular about linking R to ArcGIS. >> >> I would like to find out if any of you has been successful (or >> unsuccessful) in reading or writing ArcGIS geodatabase files directly >> from R, by using the rgdal driver, or by s...

Buenas, Me encuentro con el mismo problema, de que me dice que el argumento del if no es un "valor ausente donde TRUE/FALSE es necesario" Este es mi codigo de pruebas. readseq <- "aaaaaaaaaaa", "aaa", "aa") auxiliar <- count(readseq[j],i+2) aux_a <- auxiliar["listaa"] if(aux_a > 0){ matrizgraf3[i][k] = matrizgraf3[i][k] + 1 listaa

...b?R}9M*DtfMm>mb z??0&0ZrQOk$7r_(*Pzd=QltAd|4*2I4Z8XowZ^Kl0}p7(Ga0TitXiXfcOFM7iS~RU z=A>GyRyC8lS>~fz(As7^F8j~RN_ma-iD6Hl{_TcDM|!?*J|(LY6JbgmT1X`^ks at h| zra8I^0*XjdC?BM`qq}KZk+s9HeG at wk;po|6h)bb&8P=zUwc7}Ms*(TW1C4V{|5DuT zU8)I3?5*~F-iy at dbb3}x&-v)t?71w*5t}4WZHoM~5tV$M)@PdVQ6AAGJ8_q>8qmps zsR`AAF70-8ho`0BB64YJC5upxb|ziM5x(Kzml3|<;-i|0cyPJu+z3u&jS^^NXwj#| z4bzMcEjfI48L!!#KI;>u$4i!bZ36|8hXzl*E6dtr(C;DaHkf){PR<U4`Kl$h*I>LE zt2LNxWM}U(n071s#9;a&m3?Y3r7$OFn*kk*?KD_cGd4l=*x!@5x)t56N(h$tauvqf zU3AODYBlhQhUY3Zek=N8;E)FGUsOmcx>BX%4dSy5pDV;Cktjs5E)k0pHQHtNB...