search for: 347

...10/16 10:11:21.392982, 10, pid=1440, effective(0, 0), real(0, 0), class=winbind] ../source3/winbindd/winbindd.c:734(process_request) process_request: Handling async request 58217:PAM_AUTH_CRAP [2017/10/16 10:11:21.912764, 5, pid=1440, effective(0, 0), real(0, 0)] ../auth/kerberos/kerberos_pac.c:347(kerberos_decode_pac) PAC Decode: Failed to verify the service signature: Invalid argument [2017/10/16 10:11:21.912829, 5, pid=1440, effective(0, 0), real(0, 0)] ../auth/kerberos/kerberos_pac.c:347(kerberos_decode_pac) PAC Decode: Failed to verify the service signature: Invalid argument [2017...

...id=1440, effective(0, 0), > real(0, 0), class=winbind] > ../source3/winbindd/winbindd.c:734(process_request) > process_request: Handling async request 58217:PAM_AUTH_CRAP > [2017/10/16 10:11:21.912764, 5, pid=1440, effective(0, 0), > real(0, 0)] ../auth/kerberos/kerberos_pac.c:347(kerberos_decode_pac) > PAC Decode: Failed to verify the service signature: > Invalid argument > [2017/10/16 10:11:21.912829, 5, pid=1440, effective(0, 0), > real(0, 0)] ../auth/kerberos/kerberos_pac.c:347(kerberos_decode_pac) > PAC Decode: Failed to verify the service signat...

...2982, 10, pid=1440, effective(0, 0), real(0, 0), > class=winbind] ../source3/winbindd/winbindd.c:734(process_request) > process_request: Handling async request 58217:PAM_AUTH_CRAP > [2017/10/16 10:11:21.912764, 5, pid=1440, effective(0, 0), real(0, > 0)] ../auth/kerberos/kerberos_pac.c:347(kerberos_decode_pac) PAC > Decode: Failed to verify the service signature: Invalid argument > [2017/10/16 10:11:21.912829, 5, pid=1440, effective(0, 0), real(0, > 0)] ../auth/kerberos/kerberos_pac.c:347(kerberos_decode_pac) PAC > Decode: Failed to verify the service signature: Invalid...

On Sat, 14 Oct 2017, Rowland Penny via samba wrote: > On Sat, 14 Oct 2017 05:33:31 -0400 (EDT) > me at tdiehl.org wrote: > >> On Fri, 13 Oct 2017, Rowland Penny via samba wrote: >> >>> On Fri, 13 Oct 2017 11:45:43 +0200 >>> "L.P.H. van Belle via samba" <samba at lists.samba.org> wrote: >>> >>>> Hai, >>>>

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789 ACGTGTGTACCCCC"))...

...40, effective(0, 0), real(0, 0), >> class=winbind] ../source3/winbindd/winbindd.c:734(process_request) >> process_request: Handling async request 58217:PAM_AUTH_CRAP >> [2017/10/16 10:11:21.912764, 5, pid=1440, effective(0, 0), real(0, >> 0)] ../auth/kerberos/kerberos_pac.c:347(kerberos_decode_pac) PAC >> Decode: Failed to verify the service signature: Invalid argument >> [2017/10/16 10:11:21.912829, 5, pid=1440, effective(0, 0), real(0, >> 0)] ../auth/kerberos/kerberos_pac.c:347(kerberos_decode_pac) PAC >> Decode: Failed to verify the service sig...

...day wraps. library(MASS) data(beav1) tmp <- beav1[90:93,] tmp attach(tmp) paste(day, time %/% 100, time %% 100) strptime(paste(day, time %/% 100, time %% 100), "%j %H %M") ## note that the times wrap and the times on both days 346 and 347 are ## mapped to "1900-01-01" ## Including the year in the format gets the right answer, with two ## different days appearing in the result. strptime(paste(1990, day, time %/% 100, time %% 100), "%Y %j %H %M") detach("tmp") ## > tmp &...

...classname=virKeepAlive 2020-07-14 16:29:58.220+0000: 5352: info : virKeepAliveNew:208 : RPC_KEEPALIVE_NEW: ka=0x556fbcf8e330 client=0x556fbcf8da50 2020-07-14 16:29:58.220+0000: 5352: info : virObjectRef:385 : OBJECT_REF: obj=0x556fbcf8da50 2020-07-14 16:29:58.220+0000: 5352: info : virObjectUnref:347 : OBJECT_UNREF: obj=0x556fbcf8da50 2020-07-14 16:29:58.220+0000: 5352: info : virObjectUnref:347 : OBJECT_UNREF: obj=0x556fbcf8d770 2020-07-14 16:29:58.220+0000: 5352: info : virEventGLibHandleDispatch:116 : EVENT_GLIB_DISPATCH_HANDLE: watch=11 events=1 cb=0x7f7b55b86c50 opaque=0x556fbcf8d770 2...

Hi Friends, I am new to R. On R utility class pages, creating "named.list" is described with this command : new("named.list",a=1,b=2) For large matrix having two columns, such as : "row1" 2334 "row2" 347 "row3" 379 ... I want to create a named.list like : $row1 [1] 2334 $row2 [1] 347 ... Can anyone explain how "named.list" variable can be created by using two specified columns of a dataframe or matrix object, where one of the two columns is assigned as a name (string) and...

http://bugzilla.mindrot.org/show_bug.cgi?id=347 Summary: wrong macro used Product: Portable OpenSSH Version: -current Platform: Other OS/Version: All Status: NEW Severity: normal Priority: P2 Component: sshd AssignedTo: openssh-unix-dev at mindro...

http://bugzilla.mindrot.org/show_bug.cgi?id=347 tim at multitalents.net changed: What |Removed |Added ---------------------------------------------------------------------------- Status|NEW |RESOLVED Resolution| |FIXED ------- Addition...

...eloped. The idea behind the system is that each individual client gets it's own mountpoint. Basically we have an application that creates streams. Its written in c++ and uses libshout to handle connecting to icecast. Everything works fine, as long as we keep the number of mountpoints below 347. As soon as we try to create more mountpoints, it stops, as in, it never returns a mountpoint. in our application, we create a new mountpoint by doing: shout = shout_new() this never returns after the 347th stream, so our application waits indefinatly for icecast to return a mountpoint. Our i...

...s_smb(831) Transaction 1 of length 137 [2001/04/11 19:42:21, 3] smbd/process.c:switch_message(650) switch message SMBnegprot (pid 4141) [2001/04/11 19:42:21, 3] smbd/sec_ctx.c:set_sec_ctx(310) setting sec ctx (0, 0) - sec_ctx_stack_ndx = 0 [2001/04/11 19:42:21, 3] smbd/negprot.c:reply_negprot(347) Requested protocol [PC NETWORK PROGRAM 1.0] [2001/04/11 19:42:21, 3] smbd/negprot.c:reply_negprot(347) Requested protocol [LANMAN1.0] [2001/04/11 19:42:21, 3] smbd/negprot.c:reply_negprot(347) Requested protocol [Windows for Workgroups 3.1a] [2001/04/11 19:42:21, 3] smbd/negprot.c:reply_negp...

...t sees the following sequence of dialog src 0.0.0.0 dst 255.255.255.255 proto dhcp len 342 Info DHCP Discover - transaction id 0xd70a60a8 broadcast proto arp len 42 Info Who has 10.10.145.105? Tell 10.10.145.254 src 10.10.145.254 dst 10.10.145.105 proto dhcp len 347 Info DHCP Offer - transaction id 0xd70a60a8 src 0.0.0.0 dst 255.255.255.255 proto dhcp len 347 Info DHCP Request - transaction id 0xd70a60a8 broadcast proto arp len 42 Info Who has 10.10.145.105? Tell 10.10.145.254 src 0.0.0.0 dst 255.255.255.255 proto dhcp len 3...

...27\317\330"); - update_map("\320\321\321\245\322\343\323\340\324\342\325\345\326\231\327\236"); - update_map("\330\235\331\353\332\351\333\352\334\232\335\355\336\350\337\341"); - update_map("\340\205\341\240\342\203\343\306\344\204\345\206\346\221\347\207"); - update_map("\350\212\351\202\352\210\353\211\354\215\355\241\356\214\357\213"); - update_map("\360\320\361\244\362\225\363\242\364\223\365\344\366\224\367\366"); - update_map("\370\233\371\227\372\243\373\226\374\201\375\354\376\347\377\23...

...1 in _Py_INCREF (op=<optimized out>) at /usr/include/ > python3.9/object.h:408 > #1 ?guestfs_int_py_event_callback_wrapper > ? ? (g=<optimized out>, flags=<optimized out>, array_len=0, array=0x0, buf_len= > 43, buf=0xd1dc90 "commandrvf: udevadm --debug settle -E /\347\232\204\303 > available\r\ned7 > #2 ?guestfs_int_py_event_callback_wrapper > ? ? (g=<optimized out>, callback=0x7f6dd19ec040, event=16, event_handle=0, > flags=<optimized out>, buf=0xd1dc90 "commandrvf: udevadm --debug settle -E /\ > 347\232\204\303 4 > #3 ?0x0000...

...eloped. The idea behind the system is that each individual client gets it's own mountpoint. Basically we have an application that creates streams. Its written in c++ and uses libshout to handle connecting to icecast. Everything works fine, as long as we keep the number of mountpoints below 347. As soon as we try to create more mountpoints, it stops, as in, it never returns a mountpoint. in our application, we create a new mountpoint by doing: shout = shout_new() this never returns after the 347th stream, so our application waits indefinatly for icecast to return a mountpoint. Our i...

...00,1,Dial(Zap/1/1234) BUT: It does NOT dial "1234" but it says in debug mode: -- Called 1/72976451 Apr 26 00:53:00 WARNING[10251]: chan_zap.c:5979 zt_pri_error: PRI: !! Facility message shorter than 14 bytes -- Channel 1, span 1 got hangup Apr 26 00:53:00 WARNING[25617]: app_dial.c:347 wait_for_answer: Unable to forward voice Apr 26 00:53:00 WARNING[25617]: app_dial.c:347 wait_for_answer: Unable to forward voice -- Hungup 'Zap/1-1' == No one is available to answer at this time There is one exception: One specific number is dialled, and in the client I hear the...

...sshfs normally, then on the > > server do a strace of the sftp-server process: > > > > strace -o /tmp/strace.log -p `pidof sftp-server` > > Attached the sftp-server log. Thanks. I think I can see the explanation. Here's the failure: read(3, "\0\0\0H\3\0\0\3\347\0\0\0003/mnt/exports/tools/"..., 16384) = 140 open("/mnt/exports/tools/ISE9.2i/bin/lin64/libXst_Core.so", O_RDONLY) = 105 close(105) = 0 select(5, [3], [4], NULL, NULL) = 1 (out [4]) write(4, "\0\0\0\30e\0\0\3\347\0\0\0\4\0\0\0\7F...

...of hours) where it is not possible to browse the workgroup. Thanks in advance PK Peter Kernke Senior Programmer (Infrastructure and Operations) Queensland Tertiary Admissions Centre Ltd Level 2/33 Park Road PO Box 1331, Milton, Brisbane, Australia, 4064 Ph: (07) 3858-1238 Mobile: (0408) 347 677 Fax: (07) 3368-2263 E-mail: pk@qtac.edu.au ------------- End Forwarded Message ------------- ----------------------------------------------- Peter Kernke Senior Programmer (Infrastructure and Operations) Queensland Tertiary Admissions Centre Ltd Level 2/33 Park Road PO Box 1331, Milton,...