similar to: Convert a list to matrix

I have a matrix containing -1, 0, 1, however certain rows will not have all 3 numbers. I have written some codes to compute the frequency table of how many -1s, 0s, 1s per row, but it is very ugly and not efficient if there are more than 3 numbers. Please suggest. m <- rbind(sample(0:1, replace=T, 10), sample(-1:1, replace=T, 10)) m.table <- t(apply(m, 1, function(x) c(sum(x==-1, na.rm=T),

I tried cast and melt in reshape package, but still can't convert this data frame m m [,1] [,2] [1,] "A" "1" [2,] "A" "2" [3,] "B" "3" to this form. m1 [,1] [,2] [1,] "A" "B" [2,] "1" "3" [3,] "2" NA Please help. [[alternative HTML version deleted]]

I am cleaning up comma-limited values, so that only one comma separates each value. Using the example below, as much as I try with regex, I can't remove the last comma. I hope to have a one-liner solution, if possible. gsub("^,*|,*$|(,)*", "\\1", ",,,apple,,orange,,,,,lemon,strawberry,,,,") [1] "apple,orange,lemon,strawberry,"

I am given a text file of records to be converted into a table format. I have searched related topics or packages, but can't find any similar cases. Please help. Sample record is given below. Take note the last element doesn't have a semi colon. ###---------Start of record---------------------- Name : John Height: 170cm Weight : 70kg Age: 30 Status: Married Children: 2 Employment

I need to have the maths symbol for >= in the legend, and to substitute threshold variable with its value. Somehow, various attempts weren't successful. Please help. threshold <- 0.5 plot(NA, xlab="", ylab="", main="", axes=F, xlim=c(0,1), ylim=c(0,1), xaxs="i", yaxs="i") legend(x=0, y=1, fill=c("orange", "white",

> set.seed(999) > abs(rnorm(20)) [1] 0.28174016 1.31255963 0.79518398 0.27007049 0.27730642 0.56602374 1.87865826 1.26679114 0.96774968 1.12100936 1.32546371 0.13397739 0.93874945 [14] 0.17253810 0.95765045 1.36268625 0.06833513 0.10065765 0.90134475 2.07435711 > v <- abs(rnorm(20)) > v [1] 1.2285633 0.6430443 0.3597629 0.2940356 1.1252685 0.6422657 1.1067376 0.8848404 1.5540951

I managed to find toupper() which translates all letters to uppercase. Is there a function to capitalize only the first letter of word or phrase ? Thanks

I am inserting a DNA sequence into a plot, and hope to colourize each of the four nucleotide of the DNA sequence with a unique colour i.e., A ("red"), C ("green"), G ("blue", and T ("yellow"). I use the following codes, but the DNA sequence only shows as "red" DNA <- "ACGT" plot(1, xlim = c(0,1), ylim = c(0,1), axes=F,

Hi, On my laptop, R is installed on windows XP SP2 at D:\Program Files\R\R-2.8.0, and all add-on packages are installed at D:\Program Files\R\R-2.8.0.libs. In addition, I have created two environment enviroment to ease upgrading and installation of packages. Packages installed is a mix of those from CRAN, Bioconductor and local zips. D:\My Document\My Desktop>echo %R_HOME% D:/Program

Given a dataframe m > m X Y V3 V4 1 1 A 0.5 1.2 2 1 B 0.2 1.4 3 2 A 0.1 0.9 How do I convert m to this with V4 as the cell values ? A B 1 1.2 1.4 2 0.9 NA

For example, strings <- c("aaaa", "bbbb","ccba"). How to get "aaaa", "bbbb" that do not contain "ba" ? _________________________________________________________________ [[alternative HTML version deleted]]

For example, c("dog.is.an.animal", "cat.is.an.animal", "rat.is.an.animal"). How can I identify the common prefix is ".is.an.animal" and delete it to give c("dog", "cat", "rat") ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]

I have a folder full of pngs and jpgs, and would like to consolidate them into a pdf with appropriate title and labels. Can this be done via R ? _________________________________________________________________ Easily publish your photos to your Spaces with Photo Gallery. [[alternative HTML version deleted]]

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

I am using read.table("data.txt", sep="\t") to read in a tab-limited text file. However, two columns of data were read wrongly. read.table converts "+" and "-" in the two columns to 0. I have tried setting other parameters but to no avail. TIA _________________________________________________________________ Get in touch with your inner athlete. Take the

unique(c(1:10,1)) gives 1:10 (i.e. unique values), is there any method to get only 2:10 (i.e. values that are unique) ? _________________________________________________________________ Easily edit your photos like a pro with Photo Gallery. [[alternative HTML version deleted]]

I am generating a report containing several R scripts in the appendix. Is there any way to "beautify" the R source codes in microsoft word, similar to what we see in tinn-R ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]

Hi, How do I collapse (average in the simplest case) the values of those duplicated ids (i.e., 2, 5, 6, 9) to give a table of unique ids ? t <- cbind(id=c(1:10, 2,5,6,9), value=rnorm(14)) _________________________________________________________________ [[alternative HTML version deleted]]

Hi, I have developed some scripts that basically ask for input tab-limited format files, do some processing, and output several pictures or csv. Now I need to have some gui to wrap on top of the scripts, so that end-users can select their input files, adjust some parameters for processing, and select output folder or filenames. Please advice me if there is any tools or project suitable for

I tried aggregate, apply etc, but can't get the right result. For example, m <- cbind(c(LETTERS[1:5]), c("aa", "bb", "cc", "aa", "cc")) [,1] [,2][1,] "A" "aa"[2,] "B" "bb"[3,] "C" "cc"[4,] "D" "aa"[5,] "E" "cc" how to obtain