similar to: Plotting a graph for every Level of a Factor

Hi Everyone, Have created a bar plot of the data below using the following code: barplot(TACC,space=0,names.arg=Year). I now want to add a series of connected points to represent the catch. I tried to do this using line(Catch) or points(Catch), however both of these commands result in each data point being aligned with the right edge of each bar. I need them to be solid points in the centre of

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789

# is there a bug in the calculation of the odds ratio in fisher.test? # Nicholas Horton, nhorton at smith.edu Fri Jan 22 08:29:07 EST 2010 x1 = c(rep(0, 244), rep(1, 209)) x2 = c(rep(0, 177), rep(1, 67), rep(0, 169), rep(1, 40)) or1 = sum(x1==1&x2==1)*sum(x1==0&x2==0)/ (sum(x1==1&x2==0)*sum(x1==0&x2==1)) library(epitools) or2 = oddsratio.wald(x1, x2)$measure[2,1] or3 =

Hi all, The machine I am targeting has some special requirements for some operations, say: ADD or1, ir1, r5 would add ir1 (input reg 1) and r5 and put the result in or1 (output reg 1). The point id that input and output regs have to go paired (this meaning an addition of ir1 with whatever always goes to or1, or an in general irX + whatever goes to orX). AFAIK, InstrInfo.td only allow

Hi Carlos, Jakob, The PBQP allocator was designed to support a very wide range of constraints, and can handle something like this easily. Say you have 4 of these orX/irX registers, then for any pair of virtual registers used in such an add instruction you would add the following constraint matrix to the PBQP instance: [ 0 inf inf inf ] [ inf 0 inf inf ] [ inf inf 0 inf ] [ inf inf inf 0

On Sep 7, 2010, at 3:01 AM, Carlos Sanchez de La Lama wrote: > The machine I am targeting has some special requirements for some > operations, say: > > ADD or1, ir1, r5 > > would add ir1 (input reg 1) and r5 and put the result in or1 (output reg > 1). The point id that input and output regs have to go paired (this > meaning an addition of ir1 with whatever always goes to

Buenas noches Javier y José, Estoy en contra de usar attach(), asi que propongo la siguiente alternativa con with(): # paquete require(epicalc) # los argumentos en ... pasan de epicalc:::cc # ver ?cc para mas informacion foo <- function(var1, var2, var3, ...){ or1 <- cc(var1, var2, ...) or2 <- cc(var1, var3, ...) list(or1 = or1, or2 = or2) } # datos x <-

The following piece of code triggers an 'unimplemented' exception with the message: "Can't use NEAR/PHRASE with a subexpression containing NEAR or PHRASE" Xapian::Query or1(Xapian::Query::OP_OR, Xapian::Query("one"), Xapian::Query("two")); Xapian::Query or2(Xapian::Query::OP_OR, Xapian::Query("three"),

Estimados Estoy entrenando hacer funciones que respondan a comandos, en esta caso en la salida gráfica se observa que dice : Exposure=var3 y outcome=var 1 quisiéramos que se reflejan los nombres de la base de datos : var1=estado, var2=cake, var3=chocolate Espero haberme explicado adecuadamente Adjunto tabla con datos #################################### #Comando que llama

On 12/9/2016 11:03 AM, Jim Lewis via llvm-dev wrote: > > Thanks, that helps enormously! The issue is that the match is supposed > to support both cascade and tree OR patterns, but there appears to be > a problem with the tree matching. Both test1 and test6 in the ARM > tests exercise the cascade pattern, and I remember now our fix is > confined to the tree case. > > I

Hello, I am create a <3 x i32> vector in LLVM IR. Then I insert 3 instructions and later on I try to load one instruction from the vector. The insertion seems to work, however, when I try to load a specific instruction from a vector I seems that it does not work. This is the part of my IR: %"ins or1" = insertelement <3 x i32> undef, i32 %38, i32 0 %"ins and2"

Job #1 for me with CentOS 7 is to disable the automatic window maximization. Some googling found this command: $ gsettings set org.gnome.mutter auto-maximize false No such schema 'org.gnome.mutter' and this: $ gsettings set orh.gnome.shell.overrides edge-tiling false but that had no visible effect. I couldn't find anything under Applications->documentation and I didn't see

Hello, This is the first time i'm trying to plot in R. I want to plot estimates of OR and their confidence limits, like a scatter plot: the vertical axis should be the estimated OR (with upper and lower conf. limits), and the horizontal exis should be fixed values: (1,0.8,0.7,0.6,0.5,0.4) Here is a part of my code: ...ests=matrix(ncol=3,nrow=6)

Dear R-Users I have created the following table in R: Year TACC.SNA1 Catch.SNA1 TACC.SNA2 Catch.SNA2 TACC.SNA3 Catch.SNA3 111 1985-86 9396 18595 1860 530 1486 16727 112 1986-87 3155 12195 9506 7067 4991 2300 113 1987-88 6913 2074 3740

I'm just a new user of wine. I've Downloaded the latest Wine. Now I want to install Microsoft SQL Server 2000 (Standard Edition) but i get an error after running autorun.exe. # wine autorun.exe ----------------------------------------------------------- Setup Initialization error File not found Source: 'Z:\mnt\cdrom\x86\setup\setup.ins' Target:

I am trying to copy files to a password protected drive which is "Ranch" at TACC from another network drive. I am logged in to the source drive and can run R there. The following code does not even find the destination folder. file.copy("sourcedrive/file.tar", " username@ranch.tacc.utexas.edu/uniqueID/destinationfolder/file.tar", overwrite = FALSE) Thanks in

Hmm.. I didn't explain the problem completely last time. I am creating a drop-in replacement for gcc and gfortran that runs an additional pass on the bitcode before generating the native binary. Here's whats happening: If the source code compilation process builds a static library (.a archive file), I need a means to link the `.a' file statically into the application. So if the

Hi Gordan, I received my Asus GTX 480 today (bought on ebay). Finally I succeeded in - quadrifying my GTX 480  into a Quadro 6000 ( softmod). - overpassing the 3-4GB of RAM on Windows XP 64 bits (domU) by applying a well known patch for Xen. - playing Crysis 2 and Darksiders II for a few minutes. http://img11.hostingpics.net/pics/953254ScreenshotXenSoftModedQuadro6000.png Using nvlfash I

No, I am running the LLVM pass at the compilation step. So by the time I reach the link step, the transformed bitcode has been generated. Ashay On Mon, Sep 12, 2011 at 4:12 PM, Dmitry N. Mikushin <maemarcus at gmail.com>wrote: > I see. And what's the purpose for outputting bitcode into *.o and *.a > files? Do you want to perform an LLVM pass on linking step? > > 2011/9/13

Hi, How do I tell an if statement to generate two seperate outputs. E.g If X>5 I want to create df1 and df2: if (X>5) {df1<-c(4,5,6,7,8) AND df2<-c(9,10,11,12,13)} Thanks, James -- View this message in context: http://www.nabble.com/If-statement-generates-two-outputs-tp22650844p22650844.html Sent from the R help mailing list archive at Nabble.com.