similar to: Bar Plot with Connected Points on 1 Y-Axis

Hello, I'm sorry if this seems similar to my last post but I thought it was significantly different to warrent a new thread. Using the dataset below, is there a way to generate a bar/line plot for the TACC/Catch of every lvl of stock? i.e. OR1,OR3,OR5. The picture at the bottom of this post is an example of the bar/line plot for OR1 which was generated when OR1 was the only stock in the

Dear R-Users I have created the following table in R: Year TACC.SNA1 Catch.SNA1 TACC.SNA2 Catch.SNA2 TACC.SNA3 Catch.SNA3 111 1985-86 9396 18595 1860 530 1486 16727 112 1986-87 3155 12195 9506 7067 4991 2300 113 1987-88 6913 2074 3740

Hi, How do I tell an if statement to generate two seperate outputs. E.g If X>5 I want to create df1 and df2: if (X>5) {df1<-c(4,5,6,7,8) AND df2<-c(9,10,11,12,13)} Thanks, James -- View this message in context: http://www.nabble.com/If-statement-generates-two-outputs-tp22650844p22650844.html Sent from the R help mailing list archive at Nabble.com.

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789

Buenas noches Javier y José, Estoy en contra de usar attach(), asi que propongo la siguiente alternativa con with(): # paquete require(epicalc) # los argumentos en ... pasan de epicalc:::cc # ver ?cc para mas informacion foo <- function(var1, var2, var3, ...){ or1 <- cc(var1, var2, ...) or2 <- cc(var1, var3, ...) list(or1 = or1, or2 = or2) } # datos x <-

Hi all, The machine I am targeting has some special requirements for some operations, say: ADD or1, ir1, r5 would add ir1 (input reg 1) and r5 and put the result in or1 (output reg 1). The point id that input and output regs have to go paired (this meaning an addition of ir1 with whatever always goes to or1, or an in general irX + whatever goes to orX). AFAIK, InstrInfo.td only allow

On Sep 7, 2010, at 3:01 AM, Carlos Sanchez de La Lama wrote: > The machine I am targeting has some special requirements for some > operations, say: > > ADD or1, ir1, r5 > > would add ir1 (input reg 1) and r5 and put the result in or1 (output reg > 1). The point id that input and output regs have to go paired (this > meaning an addition of ir1 with whatever always goes to

# is there a bug in the calculation of the odds ratio in fisher.test? # Nicholas Horton, nhorton at smith.edu Fri Jan 22 08:29:07 EST 2010 x1 = c(rep(0, 244), rep(1, 209)) x2 = c(rep(0, 177), rep(1, 67), rep(0, 169), rep(1, 40)) or1 = sum(x1==1&x2==1)*sum(x1==0&x2==0)/ (sum(x1==1&x2==0)*sum(x1==0&x2==1)) library(epitools) or2 = oddsratio.wald(x1, x2)$measure[2,1] or3 =

I am trying to copy files to a password protected drive which is "Ranch" at TACC from another network drive. I am logged in to the source drive and can run R there. The following code does not even find the destination folder. file.copy("sourcedrive/file.tar", " username@ranch.tacc.utexas.edu/uniqueID/destinationfolder/file.tar", overwrite = FALSE) Thanks in

The following piece of code triggers an 'unimplemented' exception with the message: "Can't use NEAR/PHRASE with a subexpression containing NEAR or PHRASE" Xapian::Query or1(Xapian::Query::OP_OR, Xapian::Query("one"), Xapian::Query("two")); Xapian::Query or2(Xapian::Query::OP_OR, Xapian::Query("three"),

Estimados Estoy entrenando hacer funciones que respondan a comandos, en esta caso en la salida gráfica se observa que dice : Exposure=var3 y outcome=var 1 quisiéramos que se reflejan los nombres de la base de datos : var1=estado, var2=cake, var3=chocolate Espero haberme explicado adecuadamente Adjunto tabla con datos #################################### #Comando que llama

On 12/9/2016 11:03 AM, Jim Lewis via llvm-dev wrote: > > Thanks, that helps enormously! The issue is that the match is supposed > to support both cascade and tree OR patterns, but there appears to be > a problem with the tree matching. Both test1 and test6 in the ARM > tests exercise the cascade pattern, and I remember now our fix is > confined to the tree case. > > I

Hello, I am create a <3 x i32> vector in LLVM IR. Then I insert 3 instructions and later on I try to load one instruction from the vector. The insertion seems to work, however, when I try to load a specific instruction from a vector I seems that it does not work. This is the part of my IR: %"ins or1" = insertelement <3 x i32> undef, i32 %38, i32 0 %"ins and2"

No, I am running the LLVM pass at the compilation step. So by the time I reach the link step, the transformed bitcode has been generated. Ashay On Mon, Sep 12, 2011 at 4:12 PM, Dmitry N. Mikushin <maemarcus at gmail.com>wrote: > I see. And what's the purpose for outputting bitcode into *.o and *.a > files? Do you want to perform an LLVM pass on linking step? > > 2011/9/13

I see. And what's the purpose for outputting bitcode into *.o and *.a files? Do you want to perform an LLVM pass on linking step? 2011/9/13 Ashay Rane <ashay.rane at tacc.utexas.edu>: > Hmm.. I didn't explain the problem completely last time. I am creating a > drop-in replacement for gcc and gfortran that runs an additional pass on the > bitcode before generating the native

Job #1 for me with CentOS 7 is to disable the automatic window maximization. Some googling found this command: $ gsettings set org.gnome.mutter auto-maximize false No such schema 'org.gnome.mutter' and this: $ gsettings set orh.gnome.shell.overrides edge-tiling false but that had no visible effect. I couldn't find anything under Applications->documentation and I didn't see

Hmm.. I didn't explain the problem completely last time. I am creating a drop-in replacement for gcc and gfortran that runs an additional pass on the bitcode before generating the native binary. Here's whats happening: If the source code compilation process builds a static library (.a archive file), I need a means to link the `.a' file statically into the application. So if the

Hi Carlos, Jakob, The PBQP allocator was designed to support a very wide range of constraints, and can handle something like this easily. Say you have 4 of these orX/irX registers, then for any pair of virtual registers used in such an add instruction you would add the following constraint matrix to the PBQP instance: [ 0 inf inf inf ] [ inf 0 inf inf ] [ inf inf 0 inf ] [ inf inf inf 0

Sorry, at what step do you need archive? llc emits binary, it does not perform any linking, thus it does not need anything except the input bytecode file. Then during linking you can link whatever archives of binaries you want. 2011/9/13 Ashay Rane <ashay.rane at tacc.utexas.edu>: > Thats correct. But using llc becomes a problem when I have archives (.a > files). I could, in theory,

Hi, I created the barchart below using the lattice package, however I can't seem to find a way to add another variable as a line (see the desired square/lines that I drew for the last 10 years of the plot). Can anyone help me with this? Your help is much appreciated! Code: Schart<-barchart(Catch~Year,data=SNA, scales=list(col = "black", tck = c(1, 0),x=list(rot=45)))