Displaying 20 results from an estimated 2000 matches similar to: "Bar Plot with Connected Points on 1 Y-Axis"
2009 Jan 07
2
Plotting a graph for every Level of a Factor
Hello,
I'm sorry if this seems similar to my last post but I thought it was
significantly different to warrent a new thread. Using the dataset below,
is there a way to generate a bar/line plot for the TACC/Catch of every lvl
of stock? i.e. OR1,OR3,OR5. The picture at the bottom of this post is an
example of the bar/line plot for OR1 which was generated when OR1 was the
only stock in the
2009 Feb 11
1
Table Formatting
Dear R-Users
I have created the following table in R:
Year TACC.SNA1 Catch.SNA1 TACC.SNA2 Catch.SNA2 TACC.SNA3
Catch.SNA3
111 1985-86 9396 18595 1860 530
1486 16727
112 1986-87 3155 12195 9506 7067
4991 2300
113 1987-88 6913 2074 3740
2009 Mar 22
5
If statement generates two outputs
Hi,
How do I tell an if statement to generate two seperate outputs.
E.g If X>5 I want to create df1 and df2:
if (X>5) {df1<-c(4,5,6,7,8) AND df2<-c(9,10,11,12,13)}
Thanks,
James
--
View this message in context: http://www.nabble.com/If-statement-generates-two-outputs-tp22650844p22650844.html
Sent from the R help mailing list archive at Nabble.com.
2013 Jun 11
1
Help needed in feature extraction from two input files
Hi,
Try this:
lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793
gene4 or2|347
gene5 or3|23 or7|123456789"))
lines2<-readLines(textConnection(">or1|1234
ATCGGATTCAGG
>or2|347
GAACCTATCGGGGGGGGAATTTATATATTTTA
>or3|56
ATCGGAGATATAACCAATC
>or3|23
AAAATTAACAAGAGAATAGACAAAAAAA
>or4|793
ATCTCTCTCCTCTCTCTCTAAAAA
>or7|123456789
2014 Aug 21
2
pregunta
Buenas noches Javier y José,
Estoy en contra de usar attach(), asi que propongo la siguiente alternativa
con with():
# paquete
require(epicalc)
# los argumentos en ... pasan de epicalc:::cc
# ver ?cc para mas informacion
foo <- function(var1, var2, var3, ...){
or1 <- cc(var1, var2, ...)
or2 <- cc(var1, var3, ...)
list(or1 = or1, or2 = or2)
}
# datos
x <-
2010 Sep 07
2
[LLVMdev] Complex regalloc contraints
Hi all,
The machine I am targeting has some special requirements for some
operations, say:
ADD or1, ir1, r5
would add ir1 (input reg 1) and r5 and put the result in or1 (output reg
1). The point id that input and output regs have to go paired (this
meaning an addition of ir1 with whatever always goes to or1, or an in
general irX + whatever goes to orX).
AFAIK, InstrInfo.td only allow
2010 Sep 07
0
[LLVMdev] Complex regalloc contraints
On Sep 7, 2010, at 3:01 AM, Carlos Sanchez de La Lama wrote:
> The machine I am targeting has some special requirements for some
> operations, say:
>
> ADD or1, ir1, r5
>
> would add ir1 (input reg 1) and r5 and put the result in or1 (output reg
> 1). The point id that input and output regs have to go paired (this
> meaning an addition of ir1 with whatever always goes to
2010 Jan 27
1
Possible bug in fisher.test() (PR#14196)
# is there a bug in the calculation of the odds ratio in fisher.test?
# Nicholas Horton, nhorton at smith.edu Fri Jan 22 08:29:07 EST 2010
x1 = c(rep(0, 244), rep(1, 209))
x2 = c(rep(0, 177), rep(1, 67), rep(0, 169), rep(1, 40))
or1 = sum(x1==1&x2==1)*sum(x1==0&x2==0)/
(sum(x1==1&x2==0)*sum(x1==0&x2==1))
library(epitools)
or2 = oddsratio.wald(x1, x2)$measure[2,1]
or3 =
2013 Feb 15
1
file copy to password protected network drive
I am trying to copy files to a password protected drive which is "Ranch" at
TACC from another network drive. I am logged in to the source drive and can
run R there. The following code does not even find the destination folder.
file.copy("sourcedrive/file.tar", "
username@ranch.tacc.utexas.edu/uniqueID/destinationfolder/file.tar",
overwrite = FALSE)
Thanks in
2006 Nov 15
1
Composition of NEAR and OR
The following piece of code triggers an 'unimplemented' exception with the
message:
"Can't use NEAR/PHRASE with a subexpression containing NEAR or PHRASE"
Xapian::Query or1(Xapian::Query::OP_OR,
Xapian::Query("one"),
Xapian::Query("two"));
Xapian::Query or2(Xapian::Query::OP_OR,
Xapian::Query("three"),
2014 Aug 21
2
pregunta
Estimados
Estoy entrenando hacer funciones que respondan a comandos,
en esta caso en la salida gráfica se observa que dice : Exposure=var3 y
outcome=var 1
quisiéramos que se reflejan los nombres de la base de datos : var1=estado,
var2=cake, var3=chocolate
Espero haberme explicado adecuadamente
Adjunto tabla con datos
####################################
#Comando que llama
2016 Dec 09
0
BSWAP matching in codegen
On 12/9/2016 11:03 AM, Jim Lewis via llvm-dev wrote:
>
> Thanks, that helps enormously! The issue is that the match is supposed
> to support both cascade and tree OR patterns, but there appears to be
> a problem with the tree matching. Both test1 and test6 in the ARM
> tests exercise the cascade pattern, and I remember now our fix is
> confined to the tree case.
>
> I
2014 Jul 22
2
[LLVMdev] InsertElementInst and ExtractElementInst
Hello,
I am create a <3 x i32> vector in LLVM IR. Then I insert 3 instructions
and later on I try to load one instruction from the vector. The
insertion seems to work, however, when I try to load a specific
instruction from a vector I seems that it does not work.
This is the part of my IR:
%"ins or1" = insertelement <3 x i32> undef, i32 %38, i32 0
%"ins and2"
2011 Sep 12
1
[LLVMdev] llvm-gfortran problems
No, I am running the LLVM pass at the compilation step. So by the time I
reach the link step, the transformed bitcode has been generated.
Ashay
On Mon, Sep 12, 2011 at 4:12 PM, Dmitry N. Mikushin <maemarcus at gmail.com>wrote:
> I see. And what's the purpose for outputting bitcode into *.o and *.a
> files? Do you want to perform an LLVM pass on linking step?
>
> 2011/9/13
2011 Sep 12
0
[LLVMdev] llvm-gfortran problems
I see. And what's the purpose for outputting bitcode into *.o and *.a
files? Do you want to perform an LLVM pass on linking step?
2011/9/13 Ashay Rane <ashay.rane at tacc.utexas.edu>:
> Hmm.. I didn't explain the problem completely last time. I am creating a
> drop-in replacement for gcc and gfortran that runs an additional pass on the
> bitcode before generating the native
2014 Jul 14
1
Disable auto window maximize
Job #1 for me with CentOS 7 is to disable the automatic window maximization.
Some googling found this command:
$ gsettings set org.gnome.mutter auto-maximize false
No such schema 'org.gnome.mutter'
and this:
$ gsettings set orh.gnome.shell.overrides edge-tiling false
but that had no visible effect.
I couldn't find anything under Applications->documentation and I didn't see
2011 Sep 12
2
[LLVMdev] llvm-gfortran problems
Hmm.. I didn't explain the problem completely last time. I am creating a
drop-in replacement for gcc and gfortran that runs an additional pass on the
bitcode before generating the native binary. Here's whats happening: If the
source code compilation process builds a static library (.a archive file), I
need a means to link the `.a' file statically into the application. So if
the
2010 Sep 08
3
[LLVMdev] Complex regalloc contraints
Hi Carlos, Jakob,
The PBQP allocator was designed to support a very wide range of constraints,
and can handle something like this easily.
Say you have 4 of these orX/irX registers, then for any pair of virtual
registers used in such an add instruction you would add the following
constraint matrix to the PBQP instance:
[ 0 inf inf inf ]
[ inf 0 inf inf ]
[ inf inf 0 inf ]
[ inf inf inf 0
2011 Sep 12
0
[LLVMdev] llvm-gfortran problems
Sorry, at what step do you need archive? llc emits binary, it does not
perform any linking, thus it does not need anything except the input
bytecode file. Then during linking you can link whatever archives of
binaries you want.
2011/9/13 Ashay Rane <ashay.rane at tacc.utexas.edu>:
> Thats correct. But using llc becomes a problem when I have archives (.a
> files). I could, in theory,
2009 Mar 29
1
Two variables on one lattice barchart
Hi,
I created the barchart below using the lattice package, however I can't seem
to find a way to add another variable as a line (see the desired
square/lines that I drew for the last 10 years of the plot). Can anyone
help me with this? Your help is much appreciated!
Code:
Schart<-barchart(Catch~Year,data=SNA, scales=list(col = "black", tck = c(1,
0),x=list(rot=45)))