similar to: counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"

Hiya, I am trying to look at the similarities between a number of sequences, for example i am trying to see how similar "ababbbassdaa" is to "addffggssbbsbbs" I was wondering is the some way for me to see how similar they are in terms of, for example, number of a's, number of b's, how often a and ab are consecutive, how often abab is together etc. Any advice

Dear List, I tested the example in the reposTools vignette: library(reposTools); Loading required package: tools genRepos("Test Repository", "http://biowww.dfci.harvard.edu/~jgentry/","newRepos"); Error in rep.int(colnames(x), nr) : unimplemented type 'NULL' in 'rep' Could someone help me out with this one? I'd appreciate all help.... I am

For example, strings <- c("aaaa", "bbbb","ccba"). How to get "aaaa", "bbbb" that do not contain "ba" ? _________________________________________________________________ [[alternative HTML version deleted]]

For example, c("dog.is.an.animal", "cat.is.an.animal", "rat.is.an.animal"). How can I identify the common prefix is ".is.an.animal" and delete it to give c("dog", "cat", "rat") ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]

I am generating a report containing several R scripts in the appendix. Is there any way to "beautify" the R source codes in microsoft word, similar to what we see in tinn-R ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]

I have a folder full of pngs and jpgs, and would like to consolidate them into a pdf with appropriate title and labels. Can this be done via R ? _________________________________________________________________ Easily publish your photos to your Spaces with Photo Gallery. [[alternative HTML version deleted]]

Hi, I have developed some scripts that basically ask for input tab-limited format files, do some processing, and output several pictures or csv. Now I need to have some gui to wrap on top of the scripts, so that end-users can select their input files, adjust some parameters for processing, and select output folder or filenames. Please advice me if there is any tools or project suitable for

I tried aggregate, apply etc, but can't get the right result. For example, m <- cbind(c(LETTERS[1:5]), c("aa", "bb", "cc", "aa", "cc")) [,1] [,2][1,] "A" "aa"[2,] "B" "bb"[3,] "C" "cc"[4,] "D" "aa"[5,] "E" "cc" how to obtain

Given a dataframe m > m X Y V3 V4 1 1 A 0.5 1.2 2 1 B 0.2 1.4 3 2 A 0.1 0.9 How do I convert m to this with V4 as the cell values ? A B 1 1.2 1.4 2 0.9 NA

My goal is simple: calcuate GC content of each sequence in a list of nucleotide sequences. I have figured out how to vectorize, but all my attempts at memoization failed. Can you show me how to properly memoize my function? There is a StackOverflow post on the subject of memoization, but it does not help me: http://stackoverflow.com/questions/7262485/options-for-caching-memoization-hashing-in-r

Hi, I have a string "GGGGGGCCCAATCGCAATTCCAATT" What I want to do is to count the percentage of each letter in the string, what string functions can I use to count the number of each letter appearing in the string? For example, the letter "A" appeared 6 times, letter "T" appeared 5 times, how can I use a string function to get the these number? thanks, karena

Hi, I am casting a dataframe from long to wide format. The same codes that works for a smaller dataframe would take a long time (more than two hours and still running) for a longer dataframe of 2495227 rows and ten different predictors. How to make it more efficient ? wer <- data.frame(Name=c(1:5, 4:5), Type=c(letters[1:5], letters[4:5]), Predictor=c("A", "A",

My two matrices are roughly the sizes of m1 and m2. I tried using two apply and cor.test to compute the correlation p.values. More than an hour, and the codes are still running. Please help to make it more efficient. m1 <- matrix(rnorm(100000), ncol=100) m2 <- matrix(rnorm(10000000), ncol=100) cor.pvalues <- apply(m1, 1, function(x) { apply(m2, 1, function(y) { cor.test(x,y)$p.value

The aggregate function does "almost" all that I need to summarize a datasets, except that I can't specify exclusion of NAs without a little bit of hassle. > set.seed(143) > m <- data.frame(A=sample(LETTERS[1:5], 20, T), B=sample(LETTERS[1:10], 20, T), C=sample(c(NA, 1:4), 20, T), D=sample(c(NA,1:4), 20, T)) > m A B C D 1 E I 1 NA 2 A C NA NA 3 D I NA 3 4 C I

unique(c(1:10,1)) gives 1:10 (i.e. unique values), is there any method to get only 2:10 (i.e. values that are unique) ? _________________________________________________________________ Easily edit your photos like a pro with Photo Gallery. [[alternative HTML version deleted]]

Hi, How do I collapse (average in the simplest case) the values of those duplicated ids (i.e., 2, 5, 6, 9) to give a table of unique ids ? t <- cbind(id=c(1:10, 2,5,6,9), value=rnorm(14)) _________________________________________________________________ [[alternative HTML version deleted]]

How to optimize the for-loop to be reasonably fast for sample.size=100000000 ? You may want to change sample.size=1000 to have an idea what I am achieving. set.seed(143) A <- matrix(sample(0:1, sample.size, TRUE), ncol=10, dimnames=list(NULL, LETTERS[1:10])) B <- list() for(i in 1:10) { B[[i]] <- apply(combn(LETTERS[1:10], i), 2, function(x) { sum(apply(data.frame(A[,x]), 1,

Hi, I am trying to install Bioconductor onto R version 2.7.0 for Windows. I installed R, then followed the instructions on http://www.bioconductor.org/download, which state that you should type the following: source("http://bioconductor.org/biocLite.R") biocLite() When I do that, I get the following error: Running biocinstall version 2.2.9 with R version 2.7.0 Your version of R

I have successfully installed ADaCGH package, and trying the example in SegmentPlotWrite did produce alot of pngs and html. I tried again the same example this morning (after a long night of installation), ADaCGH crashes at mpiInit() showing the error: Loading required package: Rmpi ELAN_EXCEPTION @ --: 6 (Initialisation error) elan_init: Can't get capability from environment Aborted I

Instead of prepend or append new columns to a matrix, how to insert them to a matrix ? For example, I would like to insert 3 new columns after the 5th column of matrix m. _________________________________________________________________ [[elided Hotmail spam]] [[alternative HTML version deleted]]