similar to: Can R do this ?

Displaying 20 results from an estimated 5000 matches similar to: "Can R do this ?"

2008 Jun 25
3
selecting values that are unique, instead of selecting unique values
unique(c(1:10,1)) gives 1:10 (i.e. unique values), is there any method to get only 2:10 (i.e. values that are unique) ? _________________________________________________________________ Easily edit your photos like a pro with Photo Gallery. [[alternative HTML version deleted]]
2008 Feb 11
4
Conditional rows
Hi, Given a simple example, test <- matrix(c(0.1, 0.2, 0.1, 0.2, 0.1, 0.1, 0.3, 0.1, 0.1), 3, 3) How to generate row indexes for which their corresponding row values are less than or equal to 0.2 ? For this example, row 2 and 3 are the correct ones. Thanks [[alternative HTML version deleted]]
2008 Jul 11
2
network
Hello I am a relatively new user of R and am struggling to use the 'network' package. I have a correlation matrix (produced using 'cor'), and want to draw a network where each item showing correlation above a threshold (say 0.5) is joined by a green line, and each item showing correlation below a threshold (say -0.5) is joined by a red line. Does anyone have any hints of how to
2008 Jun 12
1
ADaCGH package crashes at mpiInit()
I have successfully installed ADaCGH package, and trying the example in SegmentPlotWrite did produce alot of pngs and html. I tried again the same example this morning (after a long night of installation), ADaCGH crashes at mpiInit() showing the error: Loading required package: Rmpi ELAN_EXCEPTION @ --: 6 (Initialisation error) elan_init: Can't get capability from environment Aborted I
2008 Feb 01
2
re placing values in a matrix
useR's, Consider: y <- c(20, 25, 30) > m <- matrix(c(0.0,1,NA,0.5,1.25,0.75, 0.5, NA, > NA),byrow=TRUE,nrow=3,ncol=3) > m [,1] [,2] [,3] [1,] 0.0 1.00 NA [2,] 0.5 1.25 0.75 [3,] 0.5 NA NA For each numeric value, I want to replace them with their corresponding y-value. The result should look like (here, each row represents a variable rather than the columns):
2008 Jan 11
2
Count unique rows/columns in a matrix
Dear List, i know there are some solutions for this in the archive, but they're not very good for numeric matrices, since they usually convert rows/columns to character strings. Is there an easy way to do $subject for numeric matrices properly, or i need to do it by hand? Thanks, Gabor
2008 Jan 26
3
Which R version created a package?
Greetings, R-ians: I would like to know which version or R was used to create a given package. I think I remember seeing that topic discussed recently but cannot find it among my notes. Can anyone tell me how to determine which version of R created a package? Thanks. Charles Annis, P.E. <mailto:Charles.Annis@StatisticalEngineering.com> Charles.Annis@StatisticalEngineering.com
2008 Feb 18
2
library(convert)
Hallo, I am running R-2.6. on Windows. I have a code which uses library(convert). Can anyone tell me which package I need to install to run this code. Everytime I receive the error message library (convert) not found. Thanks, Corinna
2008 Jan 14
3
problems with .svg
Dear everybody! I am making a graph in R and employ pstoedit to expot the .pdf-output to .svg. When I open the .svg with firefox I get the .svg-code shown wit the following header: "Mit dieser XML-Datei sind anscheinend keine Style-Informationen verkn?pft. Nachfolgend wird die Baum-Ansicht des Dokuments angezeigt." Which information should how be included? Thank you in advance. Yours,
2008 Jun 19
4
Any simple way to subset a vector of strings that do contain a particular substring ?
For example, strings <- c("aaaa", "bbbb","ccba"). How to get "aaaa", "bbbb" that do not contain "ba" ? _________________________________________________________________ [[alternative HTML version deleted]]
2008 Mar 04
4
R-Terminal
Hi there! I use an gnome-terminal for using R. When I resize the termial to the maximum size, R uses only the left side of the window. Can I tell R to use the whole window somehow? Thanks, Martin -- Ihr Partner f?r Webdesign, Webapplikationen und Webspace. http://www.roomandspace.com/ Martin Kaffanke +43 650 4514224 -------------- next part -------------- A non-text attachment was
2010 Jun 21
4
S3 generics need identical signature?
Dear all, "Writing R Extensions" explicitly says that A method must have all the arguments of the generic, including ... if the generic does. A method must have arguments in exactly the same order as the generic. If the generic specifies defaults, all methods should use the same defaults. This is clear. R CMD check even checks for this. But then how is it possible that
2008 Jul 31
4
Identifying common prefixes from a vector of words, and delete those prefixes
For example, c("dog.is.an.animal", "cat.is.an.animal", "rat.is.an.animal"). How can I identify the common prefix is ".is.an.animal" and delete it to give c("dog", "cat", "rat") ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]
2009 Apr 06
5
Search for a graph package - see link
Hi to all, does anybody knows whether there is a package to plot those http://www.equine-science.de/temp/graph.jpg graphs. the thickness of the points and/or the lines should be represent the numbers of behaviours With kind regards Knut
2007 May 09
3
Removing a list of Objects
Hi, I have a simple beginner's question on removing a list of objects. Say I have objects C243.Daily1, C243.Daily2...C243.Daily5 in my workspace. I'd like to remove these without using rm five times. So I write. > a <- list(paste("C243.Daily",sep="",1:5)) > rm(a) Obviously this wouldn't work, as it would only remove the object a. But is there any way
2008 May 09
3
For Social Network Analysis-Graph Analysis - How to convert 2 mode data to 1 mode data?
Hi, Does anyone know of a package in R that has a function to convert network data (e.g. an adjacency matrix or ) from 2-mode to 1-mode? I am conducting social network analysis. I know that Pajek has this function under Net --> Transform --> 2-mode to 1-mode --> Rows. I have searched the documentation under packages 'sna', 'network', 'igraph', and
2008 Jul 15
5
counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]
2011 Nov 22
3
On-demand importing of a package
Dear All, in some functions of my package, I use the Matrix S4 class, as defined in the Matrix package. I don't want to depend on Matrix, however, because my package is perfectly fine without Matrix, most of the functionality does not need Matrix. Matrix is so included in the 'Suggests' line. I load Matrix via require(), from the functions that really need it. This mostly works
2008 Dec 26
2
question about SNA in R, thanks!
Dear colleagues, I'm trying to have a look at the Assortative and Disassortative ( http://en.wikipedia.org/wiki/Assortative_mixing) of the network I have. But it seems that the igraph hasn't mentioned that yet. I have to get the in/out degree of the vertices of each edge and calculate the Pearson's Correlation coefficient which seems to be quite a huge task for me. :( So I wonder if
2008 Sep 13
3
Beautify R scripts in microsoft word
I am generating a report containing several R scripts in the appendix. Is there any way to "beautify" the R source codes in microsoft word, similar to what we see in tinn-R ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]