Displaying 20 results from an estimated 5000 matches similar to: "Can R do this ?"
2008 Jun 25
3
selecting values that are unique, instead of selecting unique values
unique(c(1:10,1)) gives 1:10 (i.e. unique values), is there any method to get only 2:10 (i.e. values that are unique) ?
_________________________________________________________________
Easily edit your photos like a pro with Photo Gallery.
[[alternative HTML version deleted]]
2008 Feb 11
4
Conditional rows
Hi,
Given a simple example, test <- matrix(c(0.1, 0.2, 0.1, 0.2, 0.1, 0.1, 0.3,
0.1, 0.1), 3, 3)
How to generate row indexes for which their corresponding row values are
less than or equal to 0.2 ? For this example, row 2 and 3 are the correct
ones.
Thanks
[[alternative HTML version deleted]]
2008 Jul 11
2
network
Hello
I am a relatively new user of R and am struggling to use the 'network' package. I have a correlation matrix (produced using 'cor'), and want to draw a network where each item showing correlation above a threshold (say 0.5) is joined by a green line, and each item showing correlation below a threshold (say -0.5) is joined by a red line. Does anyone have any hints of how to
2008 Jun 12
1
ADaCGH package crashes at mpiInit()
I have successfully installed ADaCGH package, and trying the example in SegmentPlotWrite did produce alot of pngs and html. I tried again the same example this morning (after a long night of installation), ADaCGH crashes at mpiInit() showing the error:
Loading required package: Rmpi
ELAN_EXCEPTION @ --: 6 (Initialisation error)
elan_init: Can't get capability from environment
Aborted
I
2008 Feb 01
2
re placing values in a matrix
useR's,
Consider:
y <- c(20, 25, 30)
> m <- matrix(c(0.0,1,NA,0.5,1.25,0.75, 0.5, NA,
> NA),byrow=TRUE,nrow=3,ncol=3)
> m
[,1] [,2] [,3]
[1,] 0.0 1.00 NA
[2,] 0.5 1.25 0.75
[3,] 0.5 NA NA
For each numeric value, I want to replace them with their corresponding
y-value. The result should look like (here, each row represents a variable
rather than the columns):
2008 Jan 11
2
Count unique rows/columns in a matrix
Dear List,
i know there are some solutions for this in the archive,
but they're not very good for numeric matrices, since they
usually convert rows/columns to character strings. Is there
an easy way to do $subject for numeric matrices properly,
or i need to do it by hand?
Thanks,
Gabor
2008 Jan 26
3
Which R version created a package?
Greetings, R-ians:
I would like to know which version or R was used to create a given package.
I think I remember seeing that topic discussed recently but cannot find it
among my notes. Can anyone tell me how to determine which version of R
created a package?
Thanks.
Charles Annis, P.E.
<mailto:Charles.Annis@StatisticalEngineering.com>
Charles.Annis@StatisticalEngineering.com
2008 Feb 18
2
library(convert)
Hallo,
I am running R-2.6. on Windows. I have a code which uses
library(convert). Can anyone tell me which package I need to install to
run this code. Everytime I receive the error message library (convert)
not found.
Thanks, Corinna
2008 Jan 14
3
problems with .svg
Dear everybody!
I am making a graph in R and employ pstoedit to expot the .pdf-output
to .svg.
When I open the .svg with firefox I get the .svg-code shown wit the
following header:
"Mit dieser XML-Datei sind anscheinend keine Style-Informationen
verkn?pft. Nachfolgend wird die Baum-Ansicht des Dokuments angezeigt."
Which information should how be included?
Thank you in advance.
Yours,
2008 Jun 19
4
Any simple way to subset a vector of strings that do contain a particular substring ?
For example,
strings <- c("aaaa", "bbbb","ccba").
How to get "aaaa", "bbbb" that do not contain "ba" ?
_________________________________________________________________
[[alternative HTML version deleted]]
2008 Mar 04
4
R-Terminal
Hi there!
I use an gnome-terminal for using R. When I resize the termial to the
maximum size, R uses only the left side of the window. Can I tell R to
use the whole window somehow?
Thanks,
Martin
--
Ihr Partner f?r Webdesign, Webapplikationen und Webspace.
http://www.roomandspace.com/
Martin Kaffanke +43 650 4514224
-------------- next part --------------
A non-text attachment was
2010 Jun 21
4
S3 generics need identical signature?
Dear all,
"Writing R Extensions" explicitly says that
A method must have all the arguments of the generic, including ...
if the generic does.
A method must have arguments in exactly the same order as the generic.
If the generic specifies defaults, all methods should use the same
defaults.
This is clear. R CMD check even checks for this.
But then how is it possible that
2008 Jul 31
4
Identifying common prefixes from a vector of words, and delete those prefixes
For example, c("dog.is.an.animal", "cat.is.an.animal", "rat.is.an.animal"). How can I identify the common prefix is ".is.an.animal" and delete it to give c("dog", "cat", "rat") ?
Thanks
_________________________________________________________________
[[alternative HTML version deleted]]
2009 Apr 06
5
Search for a graph package - see link
Hi to all,
does anybody knows whether there is a package to plot those
http://www.equine-science.de/temp/graph.jpg
graphs.
the thickness of the points and/or the lines should be represent the
numbers of behaviours
With kind regards Knut
2007 May 09
3
Removing a list of Objects
Hi,
I have a simple beginner's question on removing a list of
objects. Say I have objects C243.Daily1, C243.Daily2...C243.Daily5 in my
workspace. I'd like to remove these without using rm five times.
So I write.
> a <- list(paste("C243.Daily",sep="",1:5))
> rm(a)
Obviously this wouldn't work, as it would only remove the object a.
But is there any way
2008 May 09
3
For Social Network Analysis-Graph Analysis - How to convert 2 mode data to 1 mode data?
Hi,
Does anyone know of a package in R that has a function to convert
network data (e.g. an adjacency matrix or ) from 2-mode to 1-mode? I am
conducting social network analysis. I know that Pajek has this function
under Net --> Transform --> 2-mode to 1-mode --> Rows. I have searched
the documentation under packages 'sna', 'network', 'igraph', and
2008 Jul 15
5
counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
Any better solution than this ?
sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G")
_________________________________________________________________
[[alternative HTML version deleted]]
2011 Nov 22
3
On-demand importing of a package
Dear All,
in some functions of my package, I use the Matrix S4 class, as defined
in the Matrix package.
I don't want to depend on Matrix, however, because my package is
perfectly fine without Matrix, most of the functionality does not need
Matrix. Matrix is so included in the 'Suggests' line.
I load Matrix via require(), from the functions that really need it.
This mostly works
2008 Dec 26
2
question about SNA in R, thanks!
Dear colleagues,
I'm trying to have a look at the Assortative and Disassortative (
http://en.wikipedia.org/wiki/Assortative_mixing) of the network I have.
But it seems that the igraph hasn't mentioned that yet.
I have to get the in/out degree of the vertices of each edge and calculate
the Pearson's Correlation coefficient which seems to be quite a huge task
for me. :(
So I wonder if
2008 Sep 13
3
Beautify R scripts in microsoft word
I am generating a report containing several R scripts in the appendix. Is there any way to "beautify" the R source codes in microsoft word, similar to what we see in tinn-R ?
Thanks
_________________________________________________________________
[[alternative HTML version deleted]]