similar to: How to emulate perl style of reading files ?

Dear R developers I am currently working on the seqinR package. The seqinR package allows a remote access to biological databases via a socket connection. We are using the functions socketConnection, writeLines and readLines to open the socket, send request to the server and receive response from the server respectively. Recently, a new function implemented in the socket server allows

For example, strings <- c("aaaa", "bbbb","ccba"). How to get "aaaa", "bbbb" that do not contain "ba" ? _________________________________________________________________ [[alternative HTML version deleted]]

For example, c("dog.is.an.animal", "cat.is.an.animal", "rat.is.an.animal"). How can I identify the common prefix is ".is.an.animal" and delete it to give c("dog", "cat", "rat") ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]

Hi - When I'm trying to read in a text file into a labeled character array, the memory stamp/footprint of R will exceed 4 gigs or more. I've seen this behavior on Mac OS X, Linux for AMD_64 and X86_64., and the R versions are 2.4, 2.4 and 2.2, respectively. So, it would seem that this is platform and R version independant. The file that I'm reading contains the upstream regions

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

I have a folder full of pngs and jpgs, and would like to consolidate them into a pdf with appropriate title and labels. Can this be done via R ? _________________________________________________________________ Easily publish your photos to your Spaces with Photo Gallery. [[alternative HTML version deleted]]

I am generating a report containing several R scripts in the appendix. Is there any way to "beautify" the R source codes in microsoft word, similar to what we see in tinn-R ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]

Dear all, I have DNA sequence data which are fasta-formatted as >gene A;..... AAAAACCCC TTTTTGGGG CCCTTTTTT >gene B;.... CCCCCAAAA GGGGGTTTT I want to load only the lines that start with ">" where the annotation information for the gene is contained. In principle, I can remove the sequences before loading or after loading all the lines. I just wonder if there's a way to

Hi all, I am learning R by "doing". And this is my first post. I want to use R: 1- to fetch a DNA sequence from a databank (see bellow) and 2- store it as FASTA file. The problem: neither an error is prompted nor the fasta file is created. Testing the code (see bellow), I notice that everything works until the *"write.dna" *command - which is not creating the fasta file.

Hi, I have developed some scripts that basically ask for input tab-limited format files, do some processing, and output several pictures or csv. Now I need to have some gui to wrap on top of the scripts, so that end-users can select their input files, adjust some parameters for processing, and select output folder or filenames. Please advice me if there is any tools or project suitable for

I suspect you meant WD <- "~/Documents/Scripting/R_Studio/Sequences/" but I am entirely unfamiliar with the packages you are using, and know nothing about what is on your hard drive. For future reference: A) Read the Posting Guide. This is a plain text email list, and your html formatting gets removed leaving a mess that is not always readable. B) Most frequent users of R

unique(c(1:10,1)) gives 1:10 (i.e. unique values), is there any method to get only 2:10 (i.e. values that are unique) ? _________________________________________________________________ Easily edit your photos like a pro with Photo Gallery. [[alternative HTML version deleted]]

I tried aggregate, apply etc, but can't get the right result. For example, m <- cbind(c(LETTERS[1:5]), c("aa", "bb", "cc", "aa", "cc")) [,1] [,2][1,] "A" "aa"[2,] "B" "bb"[3,] "C" "cc"[4,] "D" "aa"[5,] "E" "cc" how to obtain

Given a dataframe m > m X Y V3 V4 1 1 A 0.5 1.2 2 1 B 0.2 1.4 3 2 A 0.1 0.9 How do I convert m to this with V4 as the cell values ? A B 1 1.2 1.4 2 0.9 NA

Hi, How do I collapse (average in the simplest case) the values of those duplicated ids (i.e., 2, 5, 6, 9) to give a table of unique ids ? t <- cbind(id=c(1:10, 2,5,6,9), value=rnorm(14)) _________________________________________________________________ [[alternative HTML version deleted]]

Hi, I am casting a dataframe from long to wide format. The same codes that works for a smaller dataframe would take a long time (more than two hours and still running) for a longer dataframe of 2495227 rows and ten different predictors. How to make it more efficient ? wer <- data.frame(Name=c(1:5, 4:5), Type=c(letters[1:5], letters[4:5]), Predictor=c("A", "A",

My two matrices are roughly the sizes of m1 and m2. I tried using two apply and cor.test to compute the correlation p.values. More than an hour, and the codes are still running. Please help to make it more efficient. m1 <- matrix(rnorm(100000), ncol=100) m2 <- matrix(rnorm(10000000), ncol=100) cor.pvalues <- apply(m1, 1, function(x) { apply(m2, 1, function(y) { cor.test(x,y)$p.value

I am given a text file of records to be converted into a table format. I have searched related topics or packages, but can't find any similar cases. Please help. Sample record is given below. Take note the last element doesn't have a semi colon. ###---------Start of record---------------------- Name : John Height: 170cm Weight : 70kg Age: 30 Status: Married Children: 2 Employment

Hi! I am trying to analyse my data using amova (http://www.oga-lab.net/RGM2/func.php?rd_id=pegas:amova): My input to R is a DNA sequence file, format=fasta dna<- read.dna("XX.fasta", format="fasta") #left other options as default d<- dist.dna(dna, model="raw") g<- read.table("XXX.design") Load necessary libraries: library(pegas)

Instead of prepend or append new columns to a matrix, how to insert them to a matrix ? For example, I would like to insert 3 new columns after the 5th column of matrix m. _________________________________________________________________ [[elided Hotmail spam]] [[alternative HTML version deleted]]