Displaying 20 results from an estimated 10000 matches similar to: "How to emulate perl style of reading files ?"
2006 Nov 08
1
get compressed data via a socket connection
Dear R developers
I am currently working on the seqinR package.  The seqinR package 
allows  a  remote access to  biological databases via a socket connection.
We are using the  functions  socketConnection, writeLines and  readLines 
to open the socket, send request to the server  and receive response 
from the
server respectively.
Recently, a new function implemented in the socket server allows
2008 Jun 19
4
Any simple way to subset a vector of strings that do contain a particular substring ?
For example, 
 
strings <- c("aaaa", "bbbb","ccba"). 
 
How to get "aaaa", "bbbb" that do not contain "ba" ?
_________________________________________________________________
	[[alternative HTML version deleted]]
2008 Jul 31
4
Identifying common prefixes from a vector of words, and delete those prefixes
For example, c("dog.is.an.animal", "cat.is.an.animal", "rat.is.an.animal"). How can I identify the common prefix is ".is.an.animal" and delete it to give c("dog", "cat", "rat") ?
 
Thanks
_________________________________________________________________
	[[alternative HTML version deleted]]
2007 Jan 17
4
Memory leak with character arrays?
Hi -
When I'm trying to read in a text file into a labeled character array, 
the memory stamp/footprint of R will exceed 4 gigs or more.  I've seen 
this behavior on Mac OS X, Linux for AMD_64 and X86_64., and the R 
versions are 2.4, 2.4 and 2.2, respectively.  So, it would seem that 
this is platform and R version independant.
The file that I'm reading contains the upstream regions
2008 Jul 15
5
counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
Any better solution than this ? 
 
sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G")
_________________________________________________________________
	[[alternative HTML version deleted]]
2008 Jul 08
4
Can R do this ?
I have a folder full of pngs and jpgs, and would like to consolidate them into a pdf with appropriate title and labels. Can this be done via R ?
_________________________________________________________________
Easily publish your photos to your Spaces with Photo Gallery.
	[[alternative HTML version deleted]]
2008 Sep 13
3
Beautify R scripts in microsoft word
I am generating a report containing several R scripts in the appendix. Is there any way to "beautify" the R source codes in microsoft word, similar to what we see in tinn-R ?
 
Thanks
_________________________________________________________________
	[[alternative HTML version deleted]]
2009 Sep 15
3
how to load only lines that start with a particular symbol
Dear all,
I have DNA sequence data which are fasta-formatted as
>gene A;.....
AAAAACCCC
TTTTTGGGG
CCCTTTTTT
>gene B;....
CCCCCAAAA
GGGGGTTTT
I want to load only the lines that start with ">" where the annotation
information for the gene is contained. In principle, I can remove the
sequences before loading or after loading all the lines. I just wonder if
there's a way to
2017 Jun 17
3
write.dna command
Hi all,
I am learning R by "doing". And this is my first post.
I want to use R: 1- to fetch a DNA sequence from a databank (see bellow)
and 2- store it as FASTA file.
The problem: neither an error is prompted nor the fasta file is created.
Testing the code (see bellow), I notice that everything works until
the *"write.dna"
*command - which is not creating the fasta file.
2009 Jan 06
2
Generating GUI for r-scripts
Hi, 
 
I have developed some scripts that basically ask for input tab-limited format files, do some processing, and output several pictures or csv. Now I need to have some gui to wrap on top of the scripts, so that end-users can select their input files, adjust some parameters for processing, and select output folder or filenames. 
 
Please advice me if there is any tools or project suitable for
2017 Jun 17
0
write.dna command
I suspect you meant
WD <- "~/Documents/Scripting/R_Studio/Sequences/"
but I am entirely unfamiliar with the packages you are using, and know nothing about what is on your hard drive. 
For future reference:
A) Read the Posting Guide.  This is a plain text email list, and your html formatting gets removed leaving a mess that is not always readable. 
B) Most frequent users of R
2008 Jun 25
3
selecting values that are unique, instead of selecting unique values
unique(c(1:10,1)) gives 1:10 (i.e. unique values), is there any method to get only 2:10 (i.e. values that are unique) ?
 
 
 
_________________________________________________________________
Easily edit your photos like a pro with Photo Gallery.
	[[alternative HTML version deleted]]
2008 Jun 23
2
grouping values
I tried aggregate, apply etc, but can't get the right result. 
 
For example, 
 
m <- cbind(c(LETTERS[1:5]), c("aa", "bb", "cc", "aa", "cc"))     [,1] [,2][1,] "A"  "aa"[2,] "B"  "bb"[3,] "C"  "cc"[4,] "D"  "aa"[5,] "E"  "cc"
how to obtain
2008 Oct 30
2
how to convert data from long to wide format ?
Given a dataframe m 
> m
   X Y V3 V4
1 1 A 0.5 1.2
2 1 B 0.2 1.4
3 2 A 0.1 0.9  
How do I convert m to this with V4 as the cell values ? 
   A    B
1 1.2 1.4
2 0.9 NA
2008 Jun 10
2
Fast method to compute average values of duplicated IDs
Hi, 
 
How do I collapse (average in the simplest case) the values of those duplicated ids (i.e., 2, 5, 6, 9) to give a table of unique ids ?
 
t <- cbind(id=c(1:10, 2,5,6,9), value=rnorm(14))
 
 
 
_________________________________________________________________
	[[alternative HTML version deleted]]
2008 Dec 03
2
Speeding up casting a dataframe from long to wide format
Hi, 
 
I am casting a dataframe from long to wide format. The same codes that works for a smaller dataframe would take a long time (more than two hours and still running) for a longer dataframe of 2495227 rows and ten different predictors. How to make it more efficient ?
 
wer <- data.frame(Name=c(1:5, 4:5), Type=c(letters[1:5], letters[4:5]), Predictor=c("A", "A",
2008 Nov 26
2
Very slow: using double apply and cor.test to compute correlation p.values for 2 matrices
My two matrices are roughly the sizes of m1 and m2. I tried using two apply and cor.test to compute the correlation p.values. More than an hour, and the codes are still running. Please help to make it more efficient. 
 
m1 <- matrix(rnorm(100000), ncol=100)
m2 <- matrix(rnorm(10000000), ncol=100)
cor.pvalues <- apply(m1, 1, function(x) { apply(m2, 1, function(y) { cor.test(x,y)$p.value
2009 Feb 22
2
How to parse text file into a table?
I am given a text file of records to be converted into a table format.
I have searched related topics or packages, but can't find any similar
cases. Please help.
Sample record is given below. Take note the last element doesn't have
a semi colon.
###---------Start of record----------------------
Name : John
Height: 170cm
Weight  : 70kg
Age: 30
Status: Married
Children: 2
Employment 
2012 Feb 11
1
AMOVA error: 'bin' must be numeric or a factor
Hi!
 I am trying to analyse my data using amova 
 (http://www.oga-lab.net/RGM2/func.php?rd_id=pegas:amova):
 My input to R is a DNA sequence file, format=fasta
 	dna<- read.dna("XX.fasta", format="fasta") #left other options as 
 default
 	d<- dist.dna(dna, model="raw")
 	g<- read.table("XXX.design")
 Load necessary libraries:
 	library(pegas)
 
2008 Jun 24
2
insert new columns to a matrix
Instead of prepend or append new columns to a matrix, how to insert them to a matrix ? For example, I would like to insert 3 new columns after the 5th column of matrix m. 
_________________________________________________________________
[[elided Hotmail spam]]
	[[alternative HTML version deleted]]