Displaying 20 results from an estimated 3000 matches similar to: "Accessing Value of binom.test"
2006 Oct 19
5
binom.test
R-experts:
A quick question, please.
>From a lab exp, I got 12 positives out of 50.
To get 90% CI for this , I think binom.test might be the one to be used.
Is there a better way or function to calculate this?
> binom.test(x=12, n=50, p=12/50, conf.level = 0.90)
Exact binomial test
data: 12 and 50
number of successes = 12, number of trials = 50, p-value = 1
alternative
2008 Dec 22
3
Convert ASCII string to Decimal in R (vice versa) was: Hex
Hi Dieter,
Sorry my mistake. I wanted to convert them
into Decimal (not Hexadecimal).
Given this string, the desired answer follows:
> ascii_str <- "ORQ>IK"
79 82 81 62 73 75
> ascii_str2 <- "FDC"
70 68 67
- Gundala Viswanath
Jakarta - Indonesia
On Mon, Dec 22, 2008 at 5:49 PM, Dieter Menne
<dieter.menne at menne-biomed.de> wrote:
> Gundala
2008 Jun 24
5
Measuring Goodness of a Matrix
Hi all,
Suppose I have 2 matrices A and B.
And I want to measure how good each of this matrix is.
So I intend to compare A and B with another "gold standard"
matrix X. Meaning the more similar a matrix to X the better it is.
What is the common way in R to
measure matrix similarity (ie. A vs X, and B vs X) ?
- Gundala Viswanath
Jakarta - Indonesia
2008 Jul 07
4
Plot Mixtures of Synthetically Generated Gamma Distributions
Hi,
I have the following vector
which is created from 3 distinct distribution (three components) of gamma:
x=c(rgamma(30,shape=.2,scale=14),rgamma(30,shape=12,scale=10),rgamma(30,shape=5,scale=6))
I want to plot the density curve of X, in a way that it shows
a distinct 3 curves that represent each component.
How can I do that?
I tried this but doesn't work:
lines(density(x))
Please
2008 Aug 01
3
Grouping Index of Matrix Based on Certain Condition
Hi,
I have the following (M x N) matrix, where M = 10 and N =2
What I intend to do is to group index of (M) based on this condition
of "x_mn" , namely
For each M,
If x_m1 > x_m2, assign index of M to Group1
otherwise assign index of M into Group 2
> x
[,1] [,2]
[1,] 4.482909e-01 0.55170907
[2,] 9.479594e-01 0.05204063
[3,] 8.923553e-01 0.10764474
2008 Jun 23
3
Getting only label column of a data frame
Hi,
How can I extract the label only from a given data frame.
Fore example from this data frame.
> print(dataf)
V1 V2 V3 V4 V5 V6 V7 V8 V9
11145 14.3 17.1 31.2 41.7 45.8 49.8 68.6 70.6 72.9
3545 10.2 15.6 20.9 23.2 31.4 31.7 36.2 48.4 51.9
8951 15.2 17.5 20.0 21.4 32.4
2009 Jan 06
5
Changing Matrix Header
Dear all,
I have the following matrix.
> dat
A A A A A A A A A A
[1,] 0 0 0 0 0 0 0 0 0 0
[2,] 0 0 0 0 0 0 0 0 0 1
[3,] 0 0 0 0 0 0 0 0 0 2
How can I change it into:
[,1] [,2] [,3] [,4] [,5] [,6] [,7] [,8] [,9] [,10]
[1,] 0 0 0 0 0 0 0 0 0 0
[2,] 0 0 0 0 0 0 0 0 0 1
2006 Oct 11
2
expression as a parameter of binom.test (PR#9288)
Full_Name: Petr Savicky
Version: 2.4.0
OS: Fedora Core release 2
Submission from: (NULL) (62.24.91.47)
the error is
> binom.test(0.56*10000,10000)
Error in binom.test(0.56 * 10000, 10000) :
'x' must be nonnegative and integer
while
> binom.test(5600,10000)
yields correct result.
The same error occurrs for
> binom.test(0.57*10000,10000)
2008 Sep 09
3
Splitting Data Frame into Two Based on Source Array
Dear all,
Suppose I have this data frame:
> data_main
V1 V2
foo 13.1
bar 12.0
qux 10.4
cho 20.33
pox 8.21
And I want to split the data into two parts
first part are the one contain in the source array:
> src
[1] "bar" "pox"
and the other one the complement.
In the end we hope to get this two dataframes:
> data_child1
V1 V2
bar 13.1
pox
2008 Dec 21
3
Globbing Files in R
Dear all,
For example I want to process set of files.
Typically Perl's idiom would be:
__BEGIN__
@files = glob("/mydir/*.txt");
foreach my $file (@files) {
# process the file
}
__END__
What's the R's way to do that?
- Gundala Viswanath
Jakarta - Indonesia
2012 Aug 20
1
The difference between chisq.test binom.test and pbinom
Hello all,
I am trying to understand the different results I am getting from the
following 3 commands:
chisq.test(c(62,50), p = c(0.512,1-0.512), correct = F) # p-value = 0.3788
binom.test(x=62,n=112, p= 0.512) # p-value = 0.3961
2*(1-pbinom(62,112, .512)) # p-value = 0.329
Well, the binom.test was supposed to be "exact" and give the same results
as the pbinom, while the chisq.test
2009 Jan 09
4
Extracting File Basename without Extension
Dear all,
The basename() function returns the extension also:
> myfile <- "path1/path2/myoutput.txt"
> basename(myfile)
[1] "myoutput.txt"
Is there any other function where it just returns
plain base:
"myoutput"
i.e. without 'txt'
- Gundala Viswanath
Jakarta - Indonesia
2008 Dec 24
2
Compressing String in R
Dear all,
What's the R way to compress the string into smaller 2~3 char/digit length.
In particular I want to compress string of length >=30 characters,
e.g. ACGATACGGCGACCACCGAGATCTACACTCTTCC
The reason I want to do that is because, there are billions
of such string I want to print out. And I need to save disk space.
- Gundala Viswanath
Jakarta - Indonesia
2003 Jan 22
2
small bug in binom.test?
Hi all,
I am wondering whether there is a small bug in the binom.test function of
the ctest library (I'm using R 1.6.0 on windows 2000, but Splus 2000 seems
to have the same behaviour). Or perhaps I've misunderstood something.
the command binom.test(11,100,p=0.1) and binom.test(9,100,p=0.1) give
different p-values (see below). As 9 and 11 are equidistant from 10, the
mean of the
2002 Sep 22
3
binom.test()
Hello everybody.
Does anyone else find the last test in the following sequence odd?
Can anyone else reproduce it or is it just me?
> binom.test(100,200,0.13)$p.value
[1] 2.357325e-36
> binom.test(100,200,0.013)$p.value
[1] 6.146546e-131
> binom.test(100,200,0.0013)$p.value
[1] 1.973702e-230
> binom.test(100,200,0.00013)$p.value
[1] 0.9743334
(R 1.5.1, Linux RedHat 7.1)
--
2008 Aug 05
2
Iterating Named List
Hi all,
I have the following named list:
> print(y)
$`200052_s_at`
[1] -1066.975 -1063.893 -1062.815 -1062.121 -1059.004
$`200071_at`
[1] -959.823 -953.980 -953.886 -948.781 -974.890
$`200084_at`
[1] -1135.804 -1132.863 -1128.197 -1128.633 -1125.890
What I want to do is to iterate this name list and process its members.
To do that I attempt the following code (but failed):
__BEGIN__
ny
2008 Jun 23
2
Pairwise Partitioning of a Vector
Hi,
How can I partitioned an example vector like this
> print(myvector)
[1] 30.9 60.1 70.0 73.0 75.0 83.9 93.1 97.6 98.8 113.9
into the following pairwise partition:
PAIR1
part1 = 30.9
part2 = 60.1 70.0 73.0 75.0 83.9 93.1 97.6 98.8 113.9
PAIR2
part1 = 30.9 60.1
part2 = 70.0 73.0 75.0 83.9 93.1 97.6 98.8 113.9
....
PAIR9
part1 = 30.9
2009 Jan 13
3
Returning Non-Unique Index with Which (alternatives?)
Dear all,
I tried to find index in repo given a query with this:
> repo <- c("AAA", "AAT", "AAC", "AAG", "ATA", "ATT")
> qr <- c("AAC", "ATT", "ATT")
> which(repo%in%qr)
[1] 3 6
Note that the query contain repeating elements, yet
the output of which only returns unique.
How can I make it
2009 Jan 13
3
Extracting Hash via Vector
Dear all,
Suppose I have a hash created with this
x <- list()
for (i in c('test', 'some', 'more')){
x[[i]] <- runif(1)
}
then I want to extract the elem of that hash with
a vector
> q <- c("some", "more", "not_there")
But why this failed?
> extracted <- x[[q]]
Error in x[[q]] : subscript out of bounds
we expect the
2000 Oct 02
2
binom.test bug?
R. 1.1.0
The example below is self explanatory.
## 1 ## # works fine
> binom.test((50*.64),50,.5,alt='g')
... Exact binomial test ...
## 2 ## # WHAT ! ?
> binom.test((50*.65),50,.5,alt='g')
Error in binom.test((50 * 0.65), 50, 0.5, alt = "g") :
x must be an