similar to: Accessing Value of binom.test

R-experts: A quick question, please. >From a lab exp, I got 12 positives out of 50. To get 90% CI for this , I think binom.test might be the one to be used. Is there a better way or function to calculate this? > binom.test(x=12, n=50, p=12/50, conf.level = 0.90) Exact binomial test data: 12 and 50 number of successes = 12, number of trials = 50, p-value = 1 alternative

Hi Dieter, Sorry my mistake. I wanted to convert them into Decimal (not Hexadecimal). Given this string, the desired answer follows: > ascii_str <- "ORQ>IK" 79 82 81 62 73 75 > ascii_str2 <- "FDC" 70 68 67 - Gundala Viswanath Jakarta - Indonesia On Mon, Dec 22, 2008 at 5:49 PM, Dieter Menne <dieter.menne at menne-biomed.de> wrote: > Gundala

Hi all, Suppose I have 2 matrices A and B. And I want to measure how good each of this matrix is. So I intend to compare A and B with another "gold standard" matrix X. Meaning the more similar a matrix to X the better it is. What is the common way in R to measure matrix similarity (ie. A vs X, and B vs X) ? - Gundala Viswanath Jakarta - Indonesia

Hi, I have the following vector which is created from 3 distinct distribution (three components) of gamma: x=c(rgamma(30,shape=.2,scale=14),rgamma(30,shape=12,scale=10),rgamma(30,shape=5,scale=6)) I want to plot the density curve of X, in a way that it shows a distinct 3 curves that represent each component. How can I do that? I tried this but doesn't work: lines(density(x)) Please

Hi, I have the following (M x N) matrix, where M = 10 and N =2 What I intend to do is to group index of (M) based on this condition of "x_mn" , namely For each M, If x_m1 > x_m2, assign index of M to Group1 otherwise assign index of M into Group 2 > x [,1] [,2] [1,] 4.482909e-01 0.55170907 [2,] 9.479594e-01 0.05204063 [3,] 8.923553e-01 0.10764474

Hi, How can I extract the label only from a given data frame. Fore example from this data frame. > print(dataf) V1 V2 V3 V4 V5 V6 V7 V8 V9 11145 14.3 17.1 31.2 41.7 45.8 49.8 68.6 70.6 72.9 3545 10.2 15.6 20.9 23.2 31.4 31.7 36.2 48.4 51.9 8951 15.2 17.5 20.0 21.4 32.4

Dear all, I have the following matrix. > dat A A A A A A A A A A [1,] 0 0 0 0 0 0 0 0 0 0 [2,] 0 0 0 0 0 0 0 0 0 1 [3,] 0 0 0 0 0 0 0 0 0 2 How can I change it into: [,1] [,2] [,3] [,4] [,5] [,6] [,7] [,8] [,9] [,10] [1,] 0 0 0 0 0 0 0 0 0 0 [2,] 0 0 0 0 0 0 0 0 0 1

Full_Name: Petr Savicky Version: 2.4.0 OS: Fedora Core release 2 Submission from: (NULL) (62.24.91.47) the error is > binom.test(0.56*10000,10000) Error in binom.test(0.56 * 10000, 10000) : 'x' must be nonnegative and integer while > binom.test(5600,10000) yields correct result. The same error occurrs for > binom.test(0.57*10000,10000)

Dear all, Suppose I have this data frame: > data_main V1 V2 foo 13.1 bar 12.0 qux 10.4 cho 20.33 pox 8.21 And I want to split the data into two parts first part are the one contain in the source array: > src [1] "bar" "pox" and the other one the complement. In the end we hope to get this two dataframes: > data_child1 V1 V2 bar 13.1 pox

Dear all, For example I want to process set of files. Typically Perl's idiom would be: __BEGIN__ @files = glob("/mydir/*.txt"); foreach my $file (@files) { # process the file } __END__ What's the R's way to do that? - Gundala Viswanath Jakarta - Indonesia

Hello all, I am trying to understand the different results I am getting from the following 3 commands: chisq.test(c(62,50), p = c(0.512,1-0.512), correct = F) # p-value = 0.3788 binom.test(x=62,n=112, p= 0.512) # p-value = 0.3961 2*(1-pbinom(62,112, .512)) # p-value = 0.329 Well, the binom.test was supposed to be "exact" and give the same results as the pbinom, while the chisq.test

Dear all, The basename() function returns the extension also: > myfile <- "path1/path2/myoutput.txt" > basename(myfile) [1] "myoutput.txt" Is there any other function where it just returns plain base: "myoutput" i.e. without 'txt' - Gundala Viswanath Jakarta - Indonesia

Dear all, What's the R way to compress the string into smaller 2~3 char/digit length. In particular I want to compress string of length >=30 characters, e.g. ACGATACGGCGACCACCGAGATCTACACTCTTCC The reason I want to do that is because, there are billions of such string I want to print out. And I need to save disk space. - Gundala Viswanath Jakarta - Indonesia

Hi all, I am wondering whether there is a small bug in the binom.test function of the ctest library (I'm using R 1.6.0 on windows 2000, but Splus 2000 seems to have the same behaviour). Or perhaps I've misunderstood something. the command binom.test(11,100,p=0.1) and binom.test(9,100,p=0.1) give different p-values (see below). As 9 and 11 are equidistant from 10, the mean of the

Hello everybody. Does anyone else find the last test in the following sequence odd? Can anyone else reproduce it or is it just me? > binom.test(100,200,0.13)$p.value [1] 2.357325e-36 > binom.test(100,200,0.013)$p.value [1] 6.146546e-131 > binom.test(100,200,0.0013)$p.value [1] 1.973702e-230 > binom.test(100,200,0.00013)$p.value [1] 0.9743334 (R 1.5.1, Linux RedHat 7.1) --

Hi all, I have the following named list: > print(y) $`200052_s_at` [1] -1066.975 -1063.893 -1062.815 -1062.121 -1059.004 $`200071_at` [1] -959.823 -953.980 -953.886 -948.781 -974.890 $`200084_at` [1] -1135.804 -1132.863 -1128.197 -1128.633 -1125.890 What I want to do is to iterate this name list and process its members. To do that I attempt the following code (but failed): __BEGIN__ ny

Hi, How can I partitioned an example vector like this > print(myvector) [1] 30.9 60.1 70.0 73.0 75.0 83.9 93.1 97.6 98.8 113.9 into the following pairwise partition: PAIR1 part1 = 30.9 part2 = 60.1 70.0 73.0 75.0 83.9 93.1 97.6 98.8 113.9 PAIR2 part1 = 30.9 60.1 part2 = 70.0 73.0 75.0 83.9 93.1 97.6 98.8 113.9 .... PAIR9 part1 = 30.9

Dear all, I tried to find index in repo given a query with this: > repo <- c("AAA", "AAT", "AAC", "AAG", "ATA", "ATT") > qr <- c("AAC", "ATT", "ATT") > which(repo%in%qr) [1] 3 6 Note that the query contain repeating elements, yet the output of which only returns unique. How can I make it

Dear all, Suppose I have a hash created with this x <- list() for (i in c('test', 'some', 'more')){ x[[i]] <- runif(1) } then I want to extract the elem of that hash with a vector > q <- c("some", "more", "not_there") But why this failed? > extracted <- x[[q]] Error in x[[q]] : subscript out of bounds we expect the

R. 1.1.0 The example below is self explanatory. ## 1 ## # works fine > binom.test((50*.64),50,.5,alt='g') ... Exact binomial test ... ## 2 ## # WHAT ! ? > binom.test((50*.65),50,.5,alt='g') Error in binom.test((50 * 0.65), 50, 0.5, alt = "g") : x must be an