similar to: Unexpected behaviour in reading genomic coordinate files of R-2.7.0

Hello I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")

I would like to create a subtotal table with custom bands. seq1 = seq(0, 100, by = 5) seq2 = seq(100, 1000, by = 100) Bands = c(seq1, seq2) #Prices Prices = sample(1:1000, 200, replace=F) #corresponding size for the given price above. size = sample(1:1000, 200, replace=F) How would I find the subtotal of the size based on a given price falls within a band? -- View this message in

I am using exim via dovecot_deliver to store messages in Maildir in my $HOME. I am using kmail to retrieve stuff. Unfortunately, something in my data crashes dovecot. I was using 1.0.rc14 from opensuse, but downloaded and installed 1.0.8 from the site. Here is the crash: Dec 5 18:05:09 h743107 dovecot: IMAP(kris): file mail-index-transaction.c: line 629 (mail_index_update_flags_range):

R-users, I have two vectors (of timestamps) d1 <- as.POSIXct(strptime("2.2.2002 07:00", format="%d.%m.%Y %H:%M")) d2 <- as.POSIXct(strptime("4.2.2002 07:00", format="%d.%m.%Y %H:%M")) seq1 <- seq(d1, d2, "hours") seq1 d3 <- as.POSIXct(strptime("2.2.2002 15:22", format="%d.%m.%Y %H:%M")) d4 <-

Dear RRRRRrrrrrrrrlist! I?ve got two lists which contain sets of DNA-sequences. They look something like this: List of 33 $ Cunonia_atrorubens : chr [1:247] "t" "t" "n" "t" ... $ Cunonia_balansae : chr [1:254] "t" "c" "c" "c" ... $ Cunonia_capensis : chr

Hi, I have yet another problem with Dovecot: sometimes (rarely, maybe once every few days) one of the imap processes will 'hang', consuming all available CPU time. It does not seem to 'finish' in any reasonable amount of time (in one instance I waited a few days). This process will not even exit gracefully, it needs to be killed with 'kill -9 <PID>'. It has

I just noticed one instance of this in the current CVS version: dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): mbox sync: Expunged message reappeared in mailbox /mailhome/new/o/h/mailuser/mbox (UID 2834 < 2872) dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): file mail-index-transaction.c: line 129 (mail_index_buffer_convert_to_uids): assertion failed: (*seq != 0) dovecot: Jul

Hello Julien, Am Mon, 14 Jan 2019 22:15:47 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > ** Test 1 ** > On VPN_office I use 'tcpdump -npi any icmp and host 192.168.1.3' > When pinging 192.168.1.1 from client 1, with no success, I see no packet > passing. Sorry - the tcpdump command should end with "192.168.1.1" instead of

I have three character strings represented below as seq1, seq2, and seq3. Each string has a reference character different from the other. Thus, for seq1, the reference character is U, seq2, S (3rd S from left where A is leftmost character) and for seq3 Y. seq1 = PQRTUWXYseq2 = AQSDSSDHRSseq3 = EEZYJKFFBHO I wish to generate a 3 by 26 matrix where 3 represent seq1, seq2, seq3 and 26 the letters of

Hi suppose I have two arrays x1,x2 of dimensions a1,b1,c1 and a2,b2,c2 respectively. I want x = x1 "+" x2 with dimensions c(max(a1,a2), max(b1,b2),max (c1,c2)) with x[a,b,c] = x1[a1,b1,c1] + x2[a2,b2,c2] if a <=min(a1,a2) , b<=min (b1,b2), c<=min(c1,c2) and the other bits either x1 or x2 or zero according to whether the coordinates are "in range" for

Hi all, I am new to this mailing list and I apologize if my question is naive but I couldn''t find help about it on the CRAN site. I have just manually set a "cran.repo" for yum but I don''t know how can I install the gpg key for the packages. Can you please tell me how to do it? By now I just used the --nogpgcheck and it worked fine. Thank you in advance, margherita

Hi, today I have built dovecot from cvs sources, and upgraded server from beta-7 to this newer version. Then i got problems with opening INBOX using thunderbird 1.5.0.2. The client says "Opening folder...", then, after about half a minute, blinking "connecting to the server" and returning to "Opening folder..." /var/log/maillog gets the messages: --- Jun 22

Hello Julien, Am Tue, 15 Jan 2019 09:30:23 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > In that case I see: > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq1, length 64 > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq2, length 64 > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq3, length 64 > > Packet goes

Two simple build fixes for libldm. Well, the first isn't a build fix as such, but a code improvement. Rich.

Below is code that introduces a list comprehension syntax into R, allowing expressions like: > .[ sin(x) ~ x <- (0:11)/11 ] [1] 0.00000000 0.09078392 0.18081808 0.26935891 0.35567516 0.43905397 [7] 0.51880673 0.59427479 0.66483486 0.72990422 0.78894546 0.84147098 > .[ .[x*y ~ x <- 0:3] ~ y <- 0:4] [,1] [,2] [,3] [,4] [,5] [1,] 0 0 0 0 0 [2,] 0 1 2

To some users happens this assertion failure while deleting a message. dovecot: Mar 10 08:40:44 Panic: IMAP(user): file index-sync.c: line 39 (index_mailbox_set_recent_uid): assertion failed: (seq_range_exists (&ibox->recent_flags, uid)) dovecot: Mar 10 08:40:44 Error: IMAP(user): Raw backtrace: [see bleow] dovecot: Mar 10 08:40:44 Error: child 17683 (imap) killed with signal 6 And the

Hello, my series of dates look like [1] "2012-05-30 18:30:00 UTC" "2012-05-30 19:30:00 UTC" [3] "2012-05-30 20:30:00 UTC" "2012-05-30 21:30:00 UTC" [5] "2012-05-30 22:30:00 UTC" "2012-05-30 23:30:00 UTC" [7] "2012-05-31 00:30:00 UTC" "2012-05-31 01:30:00 UTC" [9] "2012-05-31 02:30:00 UTC"

Hi, Dec 5 20:24:31 dovecot: imap(xx at yy.zz,7ckWZu1CuZFVTILa): Fatal: master: service(imap): child 7292 killed with signal 6 (core dumped) Dec 5 20:24:32 dovecot: imap(xx at yy.zz,LnAlZu1COBVVTILa): Panic: file mail-index-map.c: line 549 (mail_index_map_lookup_seq_range): assertion failed: (first_uid > 0) Dec 5 20:24:32 dovecot: imap(xx at yy.zz,LnAlZu1COBVVTILa): Error: Raw backtrace:

Hi all, I am given the a data frame in which one of the columns has more information together- see column 4, peak_loc: chr start end peak_loc cluster_TC strand peak_TC 1 chr1 564620 564649 chr1:564644..564645,+ 94 + 10 2 chr1 565369 565404 chr1:565371..565372,+ 217 + 8 3 chr1 565463 565541 chr1:565480..565481,+ 1214 + 15 4 chr1

Hi all, I read in a column which looks like "chr1:000889594-000889638", and need to break them into three columns like "chr1:", "000889594" and "000889638". How shall I do in R. Thanks a lot for your suggestions! Bill