similar to: avoiding a loop

Hi, I don't know if I am the first one to report the problem: in 2.8.0 dev2bitmap gained aa support, but "extra" is null if neither taa nor naa is specified. > dev2bitmap("plot.pdf",type="pdfwrite") Error in paste(shQuote(gsexe), " -dNOPAUSE -dBATCH -q -sDEVICE=", type, : object "extra" not found >

Stefano, Thanks for the bug report. On 14 November 2008 at 14:35, Stefano Costa wrote: | Package: r-base-core | Version: 2.8.0-1 | Severity: normal | | As in subject. The bug is reproducible on my machine with these | commands: | | > x <- rnorm(100) | > plot(density(x)) | > dev2bitmap("density.png") | Error in paste(shQuote(gsexe), " -dNOPAUSE -dBATCH -q

Dear Sirs/Madam, I am a beginner to R, and I am currently working on a data matrix which looks like this: > head(oligo) ko:K00001 ko:K00003 ko:K00005 ko:K00008 ko:K00009 ko:K00010 ko:K00012 AAA 370 631 365 67 164 455 491 KAA 603 1208 170 157 68

On Thu, Jul 7, 2011 at 1:35 PM, Anderson, Todd A <todd.a.anderson at intel.com>wrote: > ** ** > > On Thu, Jul 7, 2011 at 10:55 AM, Anderson, Todd A < > todd.a.anderson at intel.com> wrote:**** > > For the past few years, my group in Intel Labs has been working on a > project similar to LLVM and C--, and perhaps our experience in handling > roots and stack

Dear everyone I am a bit of a computer imbecile and are having problems with R. I am using R in my research project to do chi-square tests on data imported from excel . However I have som missing data in one of my variables (columns) and I need R to "exclude" these and make chi-square test on the data that I have. I use a formula to make 2x2 tables which is: data <-

On Thu, Jul 7, 2011 at 10:55 AM, Anderson, Todd A <todd.a.anderson at intel.com<mailto:todd.a.anderson at intel.com>> wrote: For the past few years, my group in Intel Labs has been working on a project similar to LLVM and C--, and perhaps our experience in handling roots and stack walking could be useful in deciding how LLVM should evolve in the GC area. Our project is called Pillar

My thoughts are many, and inline below: On Thu, Jul 7, 2011 at 10:55 AM, Anderson, Todd A <todd.a.anderson at intel.com > wrote: > For the past few years, my group in Intel Labs has been working on a > project similar to LLVM and C--, and perhaps our experience in handling > roots and stack walking could be useful in deciding how LLVM should evolve > in the GC area. Our

Hi, is not there any way to tell grid() the starting value? With nx,ny I get the right number of grid cells, but not on the exact values I would like them. (I know I can do it with abline(), just asking for an easier way, i.e. grid(nx,nx,start.x,start.y)) An alternative way (which would solve another problem) would be making the axes coincident with the rectangular plot region, that is, if

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

I have just noticed this message in my kernel logs, reporting the possibility of an error with my memory. This would go a long way towards explaining the problems i''ve been having. This particular error is occuring when i''m not running xen so is obviously not something brought on by xen itself. The strange thing is that the NMI error is always followed by the TLAN: eth0: Adaptor

Hi all, I was wondering if there is a function kind of similar that splits a dataframe, applies a function to each row and returns in a data frame. I know ddply but this one isn?t useful in this situation. I have a dataframe with values for each day (rows) for different objects (columns). I have values for several years. Now, I want to do calculations on only the data of that year. With the

On Jul 6, 2011, at 3:24 PM, Talin wrote: > Overall Proposal: Support marking SSA values as roots (an evolutionary approach) > > My proposal consists of three rather significant changes to LLVM: > Allow frontends to mark SSA values - or even portions of SSA values - as stack roots. > For alloca roots, add a way to communicate to LLVM when a root goes out of scope. > Transfer the

Hi Konrad I encountered a bug when trying to bring offline a cpu then online it again in HVM. As I''m not very familiar with HVM stuffs I cannot come up with a quick fix. The HVM DomU is configured with 4 vcpus. After booting into command prompt, I do following operations. # echo 0 > /sys/devices/system/cpu/cpu3/online # echo 1 > /sys/devices/system/cpu/cpu3/online With

Hi Daniel, attached is a patch that pushes most of the object file specific parsing out of AsmParser and down into MachOAsmParser. This was done as a cleanup for the ELF work. I know that you're not happy with this approach, particularly the fact that as we add more object file formats and assembler dialects, it's going to cause a class explosion. But I was hoping that we could use this

Hi List, Does anyone have experiences to relate on the various Asterisk-based PBX appliances out there? Like the Aastra 160, Digium S844i, etc. Do the Epygi Quadro and Grandstream GXE also use Asterisk? Thanks, Femi -------------- next part -------------- An HTML attachment was scrubbed... URL:

Dear list, Following a recent enquiry, I've been playing with the idea of creating a colour gradient for a polygon, using the Grid package. The idea is to draw a number of stripes of different colours, using the grid.clip function. Below is my current attempt at this, library(grid) rotate.polygon <- function(g, angle=0){ # utility function, works fine matR <- matrix(c(cos(angle),

Hello, I am performing alias analysis toward the following simple code: struct MyStruct { int * f1; int * f2; }; void NOALIAS(void* p, void* q){ } int main() { struct MyStruct s[2]; int a,b; s[0].f1 = &a; s[1].f1 = &b; NOALIAS(s[a].f1, s[b].f2); return 0; } When I use the following command to generate .bc code and conduct alias analysis: clang -c -emit-llvm t.c -O2 opt -basicaa

Hi, I've installed wine-1.3.9 on Fedora 13 x64. I've installed the i686 version due to the issues with x64 Wine and .NET. When I try to run a .NET WinForms application, I get the error: Font '?' cannot be found. This occurs even with a simple test application which just puts up a form with two buttons on it. I have installed corefonts and dotnet20, and drive_c/windows/fonts

*Motivation & Abstract* It has been observed by a number of LLVM users that the current garbage collection framework requires frontends to generate complex and inefficient code. This is primarily due to the fact that only allocas can be stack roots - it is not possible to trace SSA values directly. Because of this limitation, a frontend wanting to support garbage collection has to manually

Hallo, an alle Wine-Freaks, das Programm - bis jetzt Freeware-, ist High-End unter den Hornsimus: http://www.users.bigpond.com/dmcbean/Setup.exe , 400 kB Ich habe wine in etlichen Versionen bis zur 0.9.26 probiert, auf Debian und Mepis (ubuntu), auch Crossover von 4.2 bis zum Beta 6.3a. Es geht nicht, alle Dinge wie native dll,s andere Winvers bringen keine Besserung, IE, Dcom--hilft nicht. Alle