similar to: linear contrasts with anova

Hello All: I have a vector of data, z > z [1] 0.1 0.1 0.1 0.1 0.2 0.2 0.3 0.3 0.3 0.4 0.5 0.5 0.5 0.7 0.7 0.7 0.9 0.9 1.1 [20] 1.1 1.2 1.3 1.4 The first 4 elements have values of 0.1 followed 2 elements with values 0.2. When I invoke rank(z), I expected to get (1+2+3+4)/4 = 2.5 for the first 4 elements in the ranking and (5+6)/2 = 5.5 for elements 5 and 6. But what I do

I have a simple vector, called tmp that I want to subset based on another vector called vec. Everything works as expected except for below where the subsetting returns something other than the original data. Any ideas? > vec <- c(1,2,3,4,5,59,60,27,32,21) > tmp [1] 1.0 1.1 2.0 2.1 2.2 3.0 3.1 4.0 5.0 5.1 6.0 7.0 8.0 8.1 9.0 [16] 9.1 9.2 10.0 10.1 11.0 12.0 13.0 14.0

hello, I'd like know how to sort a data frame in R for example how I should do to sort by Catholic with swiss data frame like below thanks Fertility Agriculture Examination Education Catholic Infant.Mortality Courtelary 80.2 17.0 15 12 9.96 22.2 Delemont 83.1 45.1 6 9 84.84 22.2

Another request for help implementing the 'apply' functions to avoid a loop structure... I am working with a data set that includes lab measurements taken at different dates for the subjects, with some subjects having more results than others. I would like to average lab results for each subject that were taken on the same day. I can do this using a for loop, but would like to know how

En indlejret tekst med ukendt tegns?t er blevet fjernet... Navn: ikke tilg&aelig;ngelig Url: <https://stat.ethz.ch/pipermail/r-help/attachments/20081105/3106f04e/attachment.pl>

Hello zfs-discuss, One of a disk started to behave strangely. Apr 11 16:07:42 thumper-9.srv sata: [ID 801593 kern.notice] NOTICE: /pci at 1,0/pci1022,7458 at 3/pci11ab,11ab at 1: Apr 11 16:07:42 thumper-9.srv port 6: device reset Apr 11 16:07:42 thumper-9.srv scsi: [ID 107833 kern.warning] WARNING: /pci at 1,0/pci1022,7458 at 3/pci11ab,11ab at 1/disk at 6,0 (sd27): Apr 11 16:07:42 thumper-9.srv

I am grateful to Prof. Ripley for his explanation. Indeed, rounding explains it all. I take the difference between two vectors and call it "z" method.a <- c(6.3, 6.3, 3.5, 5.1, 5.5, 7.7, 6.3, 2.8, 3.4, 5.7, 5.6, 6.2, 6.6, 7.7, 7.4, 5.6, 6.3, 8.4, 5.6, 4.8, 4.3, 4.2, 3.3, 3.8, 5.7, 4.1) method.b <- c(5.2, 6.6, 2.3, 4.4, 4.1, 6.4, 5.4, 2.3, 3.2, 5.2, 4.9,

Hi. I have 2 tables, with same dimensions (8000 x 5). Something like: tab1: V1 V2 V3 V4 V5 14.23 1.71 2.43 15.6 127 13.20 1.78 2.14 11.2 100 13.16 2.36 2.67 18.6 101 14.37 1.95 2.50 16.8 113 13.24 2.59 2.87 21.0 118 tab2: V1 V2 V3 V4 V5 1.23 1.1 2.3 1.6 17 1.20 1.8 2.4 1.2 10 1.16 2.6 2.7 1.6 11 1.37 1.5 2.0 1.8 13 1.24 2.9 2.7 2.0 18 I need generate a table of averages, the

Dear all, I have the following data frame: > dat V1 V2 V3 V4 V5 V6 V7 V8 V9 1 1 AAAACACCCACCCCCCCCCCCCCCCCCCCCCCCC 9.0 18 12.00 18.0 15.0 12.0 6.0 2 1 ACGATACGGCGACCACCGAGATCTACACTCTTCC 18.0 8 12.00 18.0 15.0 12.0 18.0 3 1 ACTACTGCTCCCCCCCCACTCCCCCCCCCCCCCC 15.0 8 12.00 12.0 18.0 12.0 12.0 4 1 ACTTATACGGCGACCACCGAGATCTACACTCTTT 15.0

Dear List, I am not sure how should i optimize a log-likelihood numerically: Here is a Text book example from Statistical Inference by George Casella, 2nd Edition Casella and Berger, Roger L. Berger (2002, pp. 355, ex. 7.4 # 7.2.b): data = x = c(20.0, 23.9, 20.9, 23.8, 25.0, 24.0, 21.7, 23.8, 22.8, 23.1, 23.1, 23.5, 23.0, 23.0) n <- length(x) # likelihood from a 2 parameter Gamma(alpha,

Hello, I am trying to print a table with numbers all rounded to the same number of digits (one after the decimal), but R seems to want to not print ".0" for integers. I can go in and fix it one number at a time, but I'd like to understand the principle. Here's an example of the code. The problem is the 13th element, 21 or 21.0: >nvb_deaths <- round(ss[,10]/100,digits=1)

Hi, I'm a novice of R. I want to read the following table into R: names mpg cyl disp hp drat Mazda RX4 21.0 6 160.0 110 3.90 Mazda RX4 Wag 21.0 6 160.0 110 3.90 The command I used is: > test <- read.table(file.choose(),header=T) The result is: Error in read.table(file.choose(), header = T) : more columns than column names

R-helpers, When I use cURL in the Terminal: curl --cookie-jar cookie.txt --url "http://corpusdelespanol.org/x.asp" --user-agent "Mozilla/5.0 (Macintosh; Intel Mac OS X 10.7; rv:16.0) Gecko/20100101 Firefox/23.0" --location --include a cookie file "cookie.txt" is saved to my working directory. However, when I try what I think is the equivalent command R with RCurl:

Dear list, I want the 1st, 2nd, 5th, and 6th columns of mtcars. After copying them, the columns become numeric class rather than data frame. But, when I copy rows, they data frame retains its class. Why is this? I don't see why copying rows vs columns is so different. > class(mtcars) [1] "data.frame" > head(mtcars) mpg cyl disp hp drat wt qsec vs

Hi, I'm just starting out with R and came across R_inferno.pdf by Patrick Burns just yesterday - I recommend it! His description of how 'growing' objects (e.g. obj <- c(obj, additionalValue) eats up memory prompted me to rewrite a function (which made such calls ~210 times) so that it used indexing into a dimensioned object instead (i.e. obj[i, ] <- additionalValue). This

Dear all, I have been given a data something like below: Dat = "2 3 28.3 3.05 8 3 3 22.5 1.55 0 1 1 26.0 2.30 9 3 3 24.8 2.10 0 3 3 26.0 2.60 4 2 3 23.8 2.10 0 3 2 24.7 1.90 0 2 1 23.7 1.95 0 3 3 25.6 2.15 0 3 3 24.3 2.15 0 2 3 25.8 2.65 0 2 3 28.2 3.05 11 4 2 21.0 1.85 0 2 1 26.0 2.30 14 1 1 27.1 2.95 8 2 3 25.2 2.00 1 2 3 29.0 3.00 1 4 3 24.7 2.20 0 2 3 27.4 2.70 5 2 2 23.2 1.95

Before I go and do this another way - can I check if anyone has a way of looping through data in odfWeave (or possibly sweave) to do a repeating analysis on subsets of data? For simplicity lets use mtcars dataset in R to explain. Dataset looks like this: > mtcars mpg cyl disp hp drat wt ... Mazda RX4 21.0 6 160 110 3.90 2.62 ... Mazda RX4 Wag 21.0 6 160 110 3.90

Hi, I am a total beginner with this whole thing so please have patience! I am trying to run an S-plus program with a certain line: spline(1:nrow(y), y[,1],n=100); This crashes with: Error: NAs in foreign function call (arg 8) Apparently, this is caused by the last command of spline: u <- seq(xmin, xmax, length.out = n) .C("spline_eval", z$method, length(u), x = u, y =

hi, i''ve tried again Debian testing, with xen 3.1 binary. it works fine but i can''t have the networt working: i''ve have an ethernet card with static IP: 172.20.2.160 gateway: 172.20.2.1 uname -r :2.6.18-xen without xen, the network works fine. here''s my output: eth0 Lien encap:Ethernet HWaddr 00:0F:FE:6B:57:32 inet adr:172.20.2.160

I seem to have stumbled across another vulnerability in DIP. It appears to allow any user to gain control of arbitrary devices in /dev. For instance, I have successfully stolen keystrokes from a root login as follows... (I could also dump characters to the root console) $ whoami cesaro $ cat < /dev/tty1 <------ root login here bash: /dev/tty1: Permission denied