similar to: replace last 3 characters of string

Hi, I'm trying to run on Windows 7 a scriptfile with Rscript.exe from within Excel 2010 with the following code: Call Shell(rPath & "\Rscript.exe C:\Work\Latest\_Test.R", vbHide) The good news is: the above code works perfectly, but ... If I add white spaces to my map directory, like: Call Shell(rPath & "\Rscript.exe C:\Work\Latest 1\_Test.R", vbHide) In the

Een ingesloten tekst met niet-gespecificeerde tekenset is gescrubt ... Naam: niet beschikbaar URL: <https://stat.ethz.ch/pipermail/r-help/attachments/20081105/cffde8e4/attachment.pl>

Hi, I was wondering what the best way is to create a new dataframe based on an existing dataframe with only the unique available levels for each column (22 columns in total) in it. If some columns have less unique values than others, then those columns can be filled with blanks for the remaining part. Is it possible to make it a generic function, which is independent from the column names? Thx

Hi, I have the following data frame, where col2 is a startdate and col3 an enddate COL1 COL2 COL3 A 40462 40482 B 40462 40478 The above timeframe of 3 weeks I would like to splits it in weeks like this COL1 COL2 COL3 COL4 A 40462 40468 1 A 40469 40475 1 A 40476 40482 1 B

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

I don''t like this: i = mock(Integer) i.should_receive(:asdfasdf).and_return(''foo'') puts i.asdfasdf Shouldn''t rspec check to see that :asdfasdf is a valid message to be sending Integer? Joe

Hi all, I'm using R to find duplicates in a set of 6 files containing Part Number information. Before applying the intersect method to identify the duplicates I need to normalize the P/Ns. Converting the P/N to uppercase if alphanumerical and applying an 18 char long zero padding if numerical. When I apply the pn_formatting function (see code below) to "Part Number" column of the

I''ve set xend service properties as follows: config/vnc-listen astring \''0.0.0.0\'' config/vncpasswd astring \''vnc\'' config/default-nic astring ''nge1'' but I get an authentication error whenever I try to connect to the console with ''vncviewer :0'' - I''m on the xvm host itself. other relevant data: SunOS

Hi All, I have a machine with three network cards, and the third card(named e1000g2) is in use now. I want to use e1000g2 as default NIC when I create Guest. How can I change the default NIC? I can override the default value of config/default-nic property of svc:/system/xvm/xend. But xend still use e1000g0 when creating Guest. BTW, I can explicitly set "bridge=e1000g2" when creating

Hi all, I would like to combine elements of a vector: vec <- c("astring", "b", "cstring", "d", "e") > vec [1] "astring" "b" "cstring" "d" "e" such that for every element that contains "string" at the end, it is combined with the next element, so that I get this:

Hi All, Im getting the following error when I run virt-install: bash-3.2# virt-install -n winxp-01 --hvm -r 384 --vnc -f /etc/opt/vms/winxp-01.img -s 16 -c /etc/opt/images/windowsXP_SP2.iso Starting install... libvir: Xen Daemon error : POST operation failed: (xend.err ''Error creating domain: vncpasswd is not set up in VMconfig and xend-config.'') Traceback (most recent call

Ok, I am trying to modify some code given to me by the author of the dspam plugin for dovecot (sorry the name eludes me). I am modifying it to handle UNSEEN differently than SEEN. Below is the python code. I am not a python programmer, but I get the basic idea. ok, uids = conn.search(None, 'BEFORE', unreadsentbefore, 'SEEN') "11-May-2007 06:18:29 -0600" is the value

Hi all, I''ll attach a new version zfs-auto-snapshot including some more improvements, and probably some new bugs. Seriously, I have tested it, but certainly not all functionality, so please let me know about any (new) problems you come across. Except from the change log: - Added support to schedule using at(1), see README.zfs-auto-snapshot.txt - take_snapshot will only run if

Hi, When an integer argument is passed as value, node_set_value segfaults. Reproducer is at the end of this message The backtrace points at hivex-py.c, function get_value. While obj is non-NULL, `bytes = PyUnicode_AsUTF8String (obj);` returns NULL. Kind regards, Peter https://lekensteyn.nl #!/usr/bin/env python3 import hivex, sys h = hivex.Hivex(sys.argv[1]) print(h) val = {

Hi, This patch series is based on a prior patch[1], splitting off changes as requested and incorporating feedback from Richard Jones. It introduces type validation to avoid segmentation faults (instead, it reports an exception) and fixes handling of the bytes type in Python 3. Major changes since that series: - Drop newly introduced support for integer types for DWORD/QWORDS - Reject Unicode

> > If we do end up creating ARM binaries for the general public, your input > > and expertise will be greatly appreciated! ;) > I will be happy to provide some Debian & Ubuntu ARM packages. I just > need access to ARM server(s). I don't know if there is such server available. If so, I also would like give help. :) Regards, chenwj -- Wei-Ren Chen (陳韋任) Computer

I''m running snv93. I''m trying to install a windows hvm domU using the virt-install command: /usr/bin/virt-install -n windowsts -r 2048 -s 20 -f /data/domU/windowsts --hvm --vnc -c /dev/dsk/c0t0d0s2 The vncviewer is unable to open a connection to the xend VNC server and is failing with the Connection refused (146) error message. xend is set up with the following properties:

On 03/04/2013 11:07, Renato Golin wrote: > On 1 April 2013 22:05, Bill Wendling <wendling at apple.com > <mailto:wendling at apple.com>> wrote: > > We would like to support ARM again. > > > Hi Bill, > > Glad you asked! ;) [...] > Sylvestre, > > If we do end up creating ARM binaries for the general public, your input > and expertise will

Hi Timo, >> * LIST (\HasNoChildren) "/" "folder1" >> * LIST (\HasNoChildren) "/" "folder2" >> * LIST (\HasNoChildren) "/" {9} >> six"wafer >> . OK List completed. >> >> Note the {9} length of the following real folder name. Is this normal >> handling of special folder names ? >Yes. Well,

I have noticed that many games (Farcry 2, Fallout 3, Fallout: New Vegas, Drakensang) crash with some form of out of memory messages. So obviously something is leaking memory (whether it is wine or the game or drivers, I cannot say). But it always happens as soon as wine uses ~1.5 GB of RAM. Also I wonder if it has something to do with this bug: http://bugs.winehq.org/show_bug.cgi?id=25428 I ran