similar to: questions about string handling

Displaying 20 results from an estimated 3000 matches similar to: "questions about string handling"

2010 Aug 05
2
a question about 'read.table' with or without 'read.table'.(urgent)
Hi, I've got a quite tricky question. I have a txt file, named 'temp.txt', as the following: snp1 snp2 snp3 AA 00 00 GG GG 00 00 AA 00 I want to read the file into R. 1) when I use 'read.table' without 'header=T' option, > temp <- read.table('temp.txt') # I got > temp V1
2009 Mar 20
1
reshape dataframe
Hi, I have a large dataset on which I would like to do the following: x<-data.frame(id=c(1,2,3), snp1=c("AA","GG", "AG"),snp2=c("GG","AG","GG"),snp3=c("GG","AG","AA")) > x id snp1 snp2 snp3 1 1 AA GG GG 2 2 GG AG AG 3 3 AG GG AA And then
2013 Jul 02
2
Recoding variables based on reference values in data frame
I'm new to R (previously used SAS primarily) and I have a genetics data frame consisting of genotypes for each of 300+ subjects (ID1, ID2, ID3, ...) at 3000+ genetic locations (SNP1, SNP2, SNP3...). A small subset of the data is shown below: SNP_ID SNP1 SNP2 SNP3 SNP4 Maj_Allele C G C A Min_Allele T A T G ID1 CC GG CT AA ID2 CC GG CC AA ID3 CC GG nc AA
2011 Mar 10
1
snp-chip table
Dear R helpers I have a table and i need to make new table table1: sire snp1 snp2 snp3 snp4 snp5 snp6 snp7 snp8 snp9 snp10 snp11 snp12 snp13 snp14 snp15 8877 -1 -1 -1 -1 0 0 -1 -1 -1 0 1 1 1 -1 -1 7765 1 1 1 0 0 0 -1 1 1 1 0 0 0 1 0 8766 1 1 -1 0 -1 -1 0 -1 0 -1 -1 -1 0 1 0 6756 0 1 0 -1 1 -1 -1 0 0 0 0 -1 0 1 1 5644 -1 0 1 -1 0 0 0 0 -1 -1 0 0 0 0 1 I have table2 sire
2011 Jan 22
1
R TABELS
Hi ihave one table that look like SNP1 SNP2 SNP3 SNP4 SNP5 SIRE1 1 -1 -1 1 -1 SIRE2 1 -1 1 1 1 SIRE3 -1 -1 1 1 0 SIRE4 -1 1 1 0 1 SIRE5 -1 1 -1 -1 1 SIRE6 0 0 0 1 -1 SIRE7 -1 0 -1 1 1 SIRE8 1 -1 NA 0 NA SIRE9 -1 1 1 -1 -1 SIRE10 1 1 1 1 1 table 2 only one line SNP1 SNP2 SNP3 SNP4 SNP5 SIRE100 -1 -1 1
2009 Mar 26
4
same value in column-->delete
Hi Readers, I have a question. I have a large dataset and want to throw away columns that have the same value in the column itself and I want to know which column this was. For example > x<-data.frame(id=c(1,2,3), snp1=c("A","G", "G"),snp2=c("G","G","G"),snp3=c("G","G","A"))
2009 Feb 27
5
Filtering a dataset's columns by another dataset's column names
Hello all, I hope some of you can come to my rescue, yet again. I have two genetic datasets, and I want one of the datasets to have only the columns that are in common with the other dataset. Here is a toy example (my real datasets have hundreds of columns): Dataset 1: Individual SNP1 SNP2 SNP3 SNP4 SNP5 1 A G T C A 2 T C A G T 3 A C T
2011 Jan 23
1
SNP IMPUTATION
Hi ihave one table that look like SNP1 SNP2 SNP3 SNP4 SNP5 SIRE1 1 -1 -1 1 -1 SIRE2 1 -1 1 1 1 SIRE3 -1 -1 1 1 0 SIRE4 -1 1 1 0 1 SIRE5 -1 1 -1 -1 1 SIRE6 0 0 0 1 -1 SIRE7 -1 0 -1 1 1 SIRE8 1 -1 NA 0 NA SIRE9 -1 1 1 -1 -1 SIRE10 1 1 1 1 1 table 2 only one line SNP1 SNP2 SNP3 SNP4 SNP5 SIRE100 -1 -1 1 1 -1 I need to male
2011 Jul 27
1
SNP Tables
Hello, I have indicators for the present of absent of a snps in columns and the categorey (case control column). I would like to extract ONLY the tables and the indices (SNPS) that give me 2 x 3 tables. Some gives 2x 2 tables when one of the allelle is missing. The data look like the matrix snpmat below: so the first snp should give me the following table: (aa=0, Aa=1 and AA=2) aa
2009 Sep 01
1
permutation and reshuffling
Hi, I'm looking for an efficient code that will enable me to reshuffle data (phenotype) for certain number of individuals and creating a loop that will randomly simulate it for 10000 times *(permutation)*. I also need to find how I keep the information (p value for each SNP) gathered for all the 10000 iterations. My data set looks like this (n=500): Individual # Phenotype SNP1 SNP2
2008 May 13
2
array dimension changes with assignment
Why does the assignment of a 3178x93 object to another 3178x93 object remove the dimension attribute? > GT <- array(dim = c(6,nrow(InData),ncol(InSNPs))) > dim(GT) [1] 6 3178 93 > SNP1 <- InSNPs[InData[,"C1"],] > dim(SNP1) [1] 3178 93 > SNP2 <- InSNPs[InData[,"C2"],] > dim(SNP2) [1] 3178 93 > dim(pmin(SNP1,SNP2)) [1] 3178 93
2008 Jan 21
2
reordering huge data file
Dear R-experts, My problem is how to handle a 10GB data file containing genotype data. The file is in a particular format (Illumina final report) and needs to be altered and merged with phenotype data for further analysis. PERL seems to be an frequently used solution for this type of work, however I am inclined to think it should be doable with R. How do I open a text-file, line by line,
2010 May 28
0
how to use GenABEL genetic information??
Does anyone use the R library GenABEL? I am using it to calculate SNP interactions. I have a list of 100 SNPs, I need to look at the interaction between each of two SNPs among the list. my question is how to perform this in GenABEL. I want to use the "lm" function, but don't know how to use the SNP information. for example: result <- (lm(y~SNP1+SNP2+SNP1*SNP2)) the problem here
2011 Jan 03
0
Using PCA to correct p-values from snpMatrix
Hi R-help folks, I have been doing some single SNP association work using snpMatrix. This works well, but produces a lot of false positives, because of population structure in my data. I would like to correct the p-values (which snpMatrix gives me) for population structure, possibly using principle component analysis (PCA). My data is complicated, so here's a simple example of what
2010 Nov 03
0
how to handle 'gwaa@gtdata' ?
I have a few questions about GenABEL, gwaa data. 1) is there a universal way that most GenABEL people use to add more individuals into a 'gwaa' data? For example, I have a 'gwaa' data, but I need to add some dummy parents, for 'gwaa at phdata', it's easy to add these rows, but for 'gwaa at gtdata', I think I need to create SNP data as '0 0 0 0 0.....'
2009 Sep 22
2
glm analysis repeated for 900 variables
Dear R users, Could you help my with the following problem? I want to repeat a glm analysis with 2 independent variables for all 900 variables (snps) in my data set. So, I want to check whether snp1 has a different effect on my outcome variable in patients and controls(phenotype). And repeat that for snp2 to snp900. Is there an easy way to get a summary of the data, e.g. a list of P values of all
2011 Jun 15
4
R string functions
Hi, I have a string "GGGGGGCCCAATCGCAATTCCAATT" What I want to do is to count the percentage of each letter in the string, what string functions can I use to count the number of each letter appearing in the string? For example, the letter "A" appeared 6 times, letter "T" appeared 5 times, how can I use a string function to get the these number? thanks, karena
2009 Apr 22
3
Merging data frames, or one column/vector with a data frame filling out empty rows with NA's
Hello I have two data frames, SNP4 and SNP1: > head(SNP4) Animal Marker Y 3213 194073197 P1001 0.021088 1295 194073197 P1002 0.021088 915 194073197 P1004 0.021088 2833 194073197 P1005 0.021088 1487 194073197 P1006 0.021088 1885 194073197 P1007 0.021088 > head(SNP1) Animal Marker x 3213 194073197 P1001 2 1295 194073197 P1002 1 915 194073197
2014 Jun 03
2
LIbvirt Python Snapshot -Domain Crashing
Hi, I'm using libvirt(1.0.0) with python, for managing virtual machines.. but while taking multiple snapshot domain is crashing... Snapshot XML ------------------------- <domainsnapshot> <name>snp1</name> <creationTime></creationTime> <description>Description</description> <state></state> <domain>
2010 Jan 13
4
a question about deleting rows
I have a file like this: id n1 n2 n3 n4 n5 n6 1 3 4 7 8 10 2 2 4 1 2 4 3 10 3 7 0 0 0 0 8 4 10 1 0 0 2 3 5 11 1 0 0 0 5 what I want to do is: only if n2=0 and n3=0 and n4=0 and n5=0 then delete the row. how can I do that? thank you, karena -- View this message