similar to: finding max value in a row and reporting colum name

Hi all, I''m trying to build a routine that generates table rows with the appropriate field types (text_area and text_field for now), and filters out the ''created_at'' and ''deleted_at''. <% for column in Project.content_columns %> <tr class="ListLine<%= cycle("0","1") %>"> <td><%=

Hi-- concept_df$NewCol <- ""; kw <- "acid|ph"; bb <- grepl(kw,concept_df$concept) concept_df[dd,2] <- "chemical" The is a bit late but it accomplish the same with base R. Good luck--EK PS.. my email doesn't accept reply [[alternative HTML version deleted]]

I have two data frame. I want to use "chemical_df" to match "concept_df " concept_df <- data.frame(concept=c("butan acid ", "nano diamond particl", "slurri composit", "composit ph polis", " inorgan particl ", "grind liquid", "liquid formul", "nanoparticl", "size abras particl",

Try the stringr package. This should work chemical=c("basic", "alkalin", "alkali", "acid", " ph ", "hss") chemical_match <- str_c(chemical, collapse = "|") chemical_match concept_df$match[str_detect(concept_df$concept, chemical_match)] <- "chemical" concept_df > concept_df concept match

Hello folks, i installed asterisk 1.8 from repo: https://wiki.asterisk.org/wiki/display/AST/Asterisk+Packages And Looked at this article about CDR in mysl. http://www.voip-info.org/wiki/view/Asterisk+cdr+mysql I installed asterisk-mysql pacakge from debian repo. The cdr in mysql is working, but i can not get cdr adaptive colums are not, i use this in my extension.conf exten =>

Hi all, Imagine I have a matrix G with N rows and M columns So L=NxM is the number of different cells in my matrix. I want to create a column vector F whose size will be F(L,1) So the fisrt row in F is G(1,1) Second row in F is G(1,2) When we arrive to a point M the element M+1 will be G(2, 1) Element M+2 will be G(2,2) and so on. I´m trying but allways error.... Easy Example: G= 2 3 4

I am importing CSV data with thousands of rows, if any row contains an error from excel, the whole program crashes, so i need to delete all rows with the value of #VALUE!, all other values are non-numeric... I've tried a bunch of strategies, but nothing seems to work. Thanks ahead of time guys, Best, Cody -- View this message in context:

Hi all, I was just radomly playing with R and got the following error when trying to filter a data frame using a string: > Angel <- c(7,8,6,9,10) > Buffy <- c(8,9,4,9,10) > Firefly <- c(9,9,10,10,10) > DrHorrible <- c(10,9,9,10,10) > my.df <- data.frame(Angel, Buffy, Firefly, DrHorrible) > my.df["DrHorrible"] DrHorrible 1 10 2 9 3

Dear ?, I'm sure that there are many ways to do what you want; here's one: > cbind(concept_df, category= + ifelse(apply( + sapply(chemical_df$chemical, + function(x) grepl(x, concept_df$concept)), + 1, any), + "chemical", "")) concept category 1 butan

Hello, I am a biologist and I am dealing with files composed of columns with T or A or C or G (example below) Sometimes a column is composed of only "T" and in that case, the columns becomes a logical column TRUE (example below) I know that the argument "as.is" controls the turns off turning a column into a factor, instead becoming a character Is there something similar for

Hi all: Can someone help me count the number of rows with values in colum "a" only. assume the name of my dataframe is "weekly" I was trying i<- nrows(weekly$a) i but returns 7 when it should be 4. Thanks a b c d 27.000 27.000 1.569 0.013 160.000 27.000 1.632 0.013 146.000 27.000 1.830 0.015 70.000 27.000 2.475 0.019

Hi I get the following when I try and run "rake db:migrate" (I"m running un Ubuntu linux) ********** code ********** (in /<home hidden>) == AddRpts: migrating ========================================================= -- add_column("rpts", :integer, {:limit=>3}) rake aborted! You have a nil object when you didn''t expect it! You might have expected an

I have data.frame's with IDs and multiple columns. B/c some of IDs showed up more than once, I need sum up colum values to creat a new dataframe with unique ids. I hope there are some cheaper ways of doing it... Because the dataframe is huge, it takes almost an hour to do the task. Thanks so much in advance! Young # ------------------------- examples are here and sum.dup.r is at the

Hi all, I just noticed (the hard way of course) that when a query returns 0 rows, the columns in the resulting data.frame get dropped as well. See the following example code (where conn is an active connection to an SQLite db): > dbGetQuery(conn, "select 1 as hey, 2 as ho where 1") hey ho 1 1 2 > dbGetQuery(conn, "select 1 as hey, 2 as ho where 0") data frame

Dear all, I have the following data frame: > dat V1 V2 V3 V4 V5 V6 V7 V8 V9 1 1 AAAACACCCACCCCCCCCCCCCCCCCCCCCCCCC 9.0 18 12.00 18.0 15.0 12.0 6.0 2 1 ACGATACGGCGACCACCGAGATCTACACTCTTCC 18.0 8 12.00 18.0 15.0 12.0 18.0 3 1 ACTACTGCTCCCCCCCCACTCCCCCCCCCCCCCC 15.0 8 12.00 12.0 18.0 12.0 12.0 4 1 ACTTATACGGCGACCACCGAGATCTACACTCTTT 15.0

Hi there, b is my dataframe. I have a dataframe. I am trying to get rid of the -INF values but didnt have much luck b[which(is.finite(b))] I can get rid of it for a single column b[,1][which(is.finite(b[,2]))] but not for all dataframe I used it inside of a sapply but still no dice my guess is it might have some differing row numbers and just ignoring the columns itself. Thanks Ramya

Hey again, I didn't wat questions to get mangled up, so here's my second email. In matlab, there is the simple possibility to access colums x till last of a matrix using mydata(1:3, 5:end). In R, I so far use mydata[1:3, 5:ncol(mydata)] Is there a faster way? (in terms of typing) Thanks ahead, Berry ------------------------------------- Berry Boessenkool University of Potsdam,

Hi List, I have a raster and a polygon with attribute ID and Class. I want to have the fraction of each class present in each pixel of raster. I have use the raster::extract to get the value and weights as below. ex<-extract(raster,polygon,weighted=TRUE) this gives me [[1]] value weight 13943 0.24 13958 0.02 13959 0.84 13960 0.19 13987 0.03 13988 0.31 13990 0.30 [[2]]

Hello, I am trying to get a new vector 'x1' based on the not NA-values in column 'a' and 'b'. I found a way but I am sure this is not the best solution. So any ideas on how to "optimize" this would be great! m <- factor(c("a1", "a1", "a2", "b1", "b2", "b3", "d1", "d1"), ordered

Hi, I have to read in data which looks like this: SeriesA, 5, 5, 5, 5 SeriesB, 8, 5, 8, 8, 7, 10, 2, 7, 3 SeriesC, 5, 5, 8, 4, 7, 7, 4, 5 SeriesD, 5, 9, 5, 4, 2, 3, 10, 1 SeriesE, 7, 10, 9, 5, 8, 6, 10, 9, 5, 10, 4, 3, 2, 10, 8, 8, 10, 10, 10 SeriesF, 1, 2, 1, 5, 1, 7, 5, 7, 7, 3 There are actually much more data points in the data, each line contains between 300 and 500 values. If I use