Displaying 20 results from an estimated 300 matches similar to: "Batch files process and String parsing"
2010 Jul 07
3
how to process this in R
Here are what i am going to accomplish:
I have 400 files named as xxx.txt. the content of the file looks like the
following:
name count
1. aaa 100
2. bbb 2000
3. ccc 300
4. ddd 3000
........
more that 1000 rows in each files.
these are the areas i need help:
1. how can i only read in the files with the string patterns ggg or fff as
part of the file names?
for
2008 Nov 04
2
strange list structure question
my problem is more complex than below but I think below can suffice. i
have a list and the name of it at the top level is GGG. so, if i do an
lapply and operate on lower components in the sublist, then I can do as
shown in EXAMPLE 1 and what will come back will be named GGG at the top
level.
but, suppose that , the function inside the lapply function was more
complex and i wanted to
1999 May 27
2
Can't connect to samba from foreign network --- 'Gethostbyaddr failed' error in log.smb
I have a samba server at ip address
aaa.bbb.ccc.ddd
I can connect to it from clients on subnets aaa.bbb.eee. and
aaa.bbb.fff.
I can't connect to it from clients on ggg.hhh.
smb.conf has
hosts deny = all
hosts allow = localhost, aaa.bbb., ggg.hhh.
The client can successfully 'ping mysambaserver' (resolves to
aaa.bbb.ccc.ddd). Doing 'net view \\mysambaserver' fails with
2008 May 01
2
regular expression question
I have strings of the form
TICKER.GGG.XXXXXX.dat
but GGG is not always three characters so I can't use substr to pull it
out of the string.
Could someone tell me how to use sub to pull out the GGG but more
generally the string between the dot after the R in TICKER and the next
dot. I still don't have a very good understanding of regular
expressions but I'm trying to get that
2007 Sep 04
2
Confusion using "functions to access the function call stack" example section
I was going through the example below which is taken from the example
section in the R documentation for accessing the function call stack.
I am confused and I have 3 questions that I was hoping someone could
answer.
1) why is y equal to zero even though the call was done with gg(3)
2) what does parents are 0,1,2,0,4,5,6,7 mean ? I understand what a
parent frame is but how do the #'s relate
2020 Oct 29
2
dovecot quota-warning detection mail
OK. "passdb/userdb" Setting part
$ dovecot -n (Excerpt from change)
----------------------------------------------------------------------------
---------------------
passdb {
args = scheme=CRYPT username_format=%u /etc/dovecot/users.auth
driver = passwd-file
}
userdb {
args = username_format=%u /etc/dovecot/users.auth
driver = passwd-file
}
protocol lmtp {
info_log_path =
2012 Feb 20
2
Help on lattice barchart ploting
Hi friends,
I have following data and would like to plot this with barchart() availble
with lattice package.
RsID Freqs Genotype
AAA 63.636 1/1
AAA 32.727 1/2
AAA 3.636 2/2
BBB 85.965 2/2
BBB 14.035 2/1
CCC 63.158 1/1
CCC 21.053 1/2
CCC 15.789 2/2
DDD 26.786 2/2
DDD 46.429 2/1
DDD 26.786 1/1
EEE 32.759 2/2
EEE 43.103 2/1
2012 Jan 18
2
Table Intersection
I've got two tables....
first one(table1):
ID chrom start end
Ex1 2 152 180
Ex2 10 2000 2220
Ex3 15 3000 4000
second one ( table2):
chrom location name
2 160 Alv
2 190 GNN
2 100
2010 Mar 29
4
iptables rules
I've got a server with several ip's on eth0. I want to block all traffic
*except* to port 80 on them, but not on any other IPs, so that
eth0 is www.xxx.yyy.zzz
eth0:1 is www.xxx.yyy.ggg
eth0:2 is www.xxx.yyy.hhh
I've tried
-A RH-Firewall-1-INPUT -p tcp -d www.xxx.yyy.ggg --dport ! 80 -j DROP
-A RH-Firewall-1-INPUT -p tcp -d www.xxx.yyy.hhh --dport ! 80 -j DROP
and restarted (and
2017 Oct 31
2
Help with Nesting
How do i resolve this?
symbol <- c('RRR' ,'GGG')
for(i in seq_along(symbol)) {
dat <- Quandl("LLL/symbol[i]")
}
required solutionis a loop where Quandl is a function and it loops as flows,
Quandl("LLL/RRR")
Quandl("LLL/GGG")
2006 May 30
1
Query: lme output
Dear R-Users
I have a problem accessing some values in the output from the summary of an lme fit.
I fit the model below:
ggg <- lme (ST~ -1 + as.factor(endp):Z.sas + as.factor(endp), data=dat4a,
random=~-1 + as.factor(endp) + as.factor(endp):Z.sas|as.factor(trials),
correlation = corSymm(form=~1|as.factor(trials)/as.factor(id)), weights=varIdent(form=~1|endp))
hh
2012 Jan 08
2
uid / gid and systemusers
Hi all,
I'm facing a problem when a user (q and g in this example) is logging into dovecot. Can anybody tell some hint?
Thanks in advance.
George
/var/log/mail.log:
...
Jan 8 16:18:28 test dovecot: User q is missing UID (see mail_uid setting)
Jan 8 16:18:28 test dovecot: imap-login: Internal login failure (auth failed, 1 attempts): user=<q>, method=PLAIN, rip=AAA.BBB.CCC.DDD,
2006 Jun 01
2
Help: lme
Good day R-Users,
I have a problem accessing some values in the output from the summary of an lme fit.
The structure of my data is as shown below (I have attached a copy of the full data).
id trials endp Z.sas ST
1 1 -1 -1 42.42884
1 1 1 -1 48.12007
2 1 -1 -1 43.42878
2 1 1 -1
2004 Jul 20
2
question regarding Asterisk. X-Lite, and firewall
Hello,
I have a one-way audio problem. If any one can give me a clue on how to
solve it, I'd highly appreciate.
My configuration is:
Both Asterisk server and a SIP phone run within a LAN. Asterisk:
CVS-HEAD-06/27/04-11:42:23. SIP phone is X-Lite release 1103m build stamp
14262. The Linux box that running Asterisk server is RedHat 2.4.18-14.
Asterisk server runs on IP: 192.168.1.102. X-Lite
2010 Apr 24
4
assign value between different type: Double vs Integer
Dear list,
just to put it in a simple way:
i read.csv from csv file to create a gdata
then, create array gdata34
however, when making a loop for assigning gdata34[1,m]<-gdata[m,4], this is what happen
gdata[1,4] 's real value is 10354, however, the gdata34[1,4] turns to be 883
then i checked the type: gdata[1,4] is integer, while gdata34[1,4] is double.
Can any one give me some help
2013 May 16
2
A function that can modify an object? Or at least shows principles how to modify an object?
Hi, If I have an R object UUU, where the second element is U2, based on
"g" column of my.table
my.table of UUU is:
mmm ggg gindex map Info
aaa123 U1 1 1 1
aaa124 U1 1 2 1
bbb1378 U2 2 1 1
bbb8888 U2 2 2 0
bbb1389 U2 2 3
2011 Jul 01
13
For help in R coding
Dear all,
I am doing a project on variant calling using R.I am working on pileup file.There are 10 columns in my data frame and I want to count the number of A,C,G and T in each row for column 9.example of column 9 is given below-
.a,g,,
.t,t,,
.,c,c,
.,a,,,
.,t,t,t
.c,,g,^!.
.g,ggg.^!,
.$,,,,,.,
2007 Oct 03
4
Win2003 ADS, wbinfo -u and -g almost works
I've been chasing this problem for several days. I have taken the
3.0.26a Fedora 7 SRPM from the Samba FTP site and rebuilt it on RedHat
EL5 and installed it. It runs, but it has exactly the same problem as
the original 3.0.23c version.
I can join the domain and 'wbinfo -t' returns OK.
However, 'wbinfo -g' returns only two groups then gives a failure
message and
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2020 Oct 29
0
dovecot quota-warning detection mail
Very good.
See https://doc.dovecot.org/configuration_manual/authentication/passwd_file/
You can add the "user" field as an "extra field"
In users.auth, just add in the end "user=bbbb-ccc at ddd.example.com" to match the respective entry in /etc/dovecot/users
Good luck!
On 10/29/20 2:02 PM, ?? ?? wrote:
> OK. "passdb/userdb" Setting part
>
> $