similar to: sequence clustering and assembly

Hi everyone. I installed affylmGUI and oneChannelGUI package on R 2.7.1 with the latest version of BioC. After I start R, I do get an error that says "Error in loadNamespace(name) : there is no package called 'affylmGUI'" and a pop-up window with a message "fatal error : unable to restore saved data in .Rdata". I would really appreciate your suggestions on how to fix

Dear Bert, thank you for your response. here it is the piece of R code : given 3 data frames below --- N <- data.frame(N=c("n1","n2","n3","n4")) M <- data.frame(M=c("m1","m2","m3","m4","m5")) C <- data.frame(n=c("n1","n2","n3"),

Hi, please could you recommend a R package that computes a 2 sample z-test ? thanks, Bogdan [[alternative HTML version deleted]]

Hi Bogdan, Kinda messy, but: N <- data.frame(N=c("n1","n2","n3","n4")) M <- data.frame(M=c("m1","m2","m3","m4","m5")) C <- data.frame(n=c("n1","n2","n3"), m=c("m1","m1","m3"), I=c(100,300,400))

> On Jun 6, 2017, at 4:01 AM, Jim Lemon <drjimlemon at gmail.com> wrote: > > Hi Bogdan, > Kinda messy, but: > > N <- data.frame(N=c("n1","n2","n3","n4")) > M <- data.frame(M=c("m1","m2","m3","m4","m5")) > C <-

Hi, and my apologies for the following very naive question : I would like to read a column of numbers in R and plot a histogram. eg : x<-read.table("txSTART"); y<-as.numeric(x); and I do obtain the error : Error: (list) object cannot be coerced to type 'double'. Please could you let me know the way to fix it. thanks, bogdan <r-help@r-project.org> [[alternative

Dear all, please could you advise me on the following : I've written a R script that reads 3 arguments from the command line, i.e. : " args <- commandArgs(TRUE) TUMOR <- args[1] GERMLINE <- args[2] CHR <- args[3] ". when I submit the R script to a PBS HPC scheduler, I do the following (below), but ... I am getting an error message. (I am not posting the error message,

Here's another approach: N <- data.frame(N=c("n1","n2","n3","n4")) M <- data.frame(M=c("m1","m2","m3","m4","m5")) C <- data.frame(n=c("n1","n2","n3"), m=c("m1","m1","m3"), I=c(100,300,400)) # Rebuild the factors using M and N C$m <-

Thank you David. Using xtabs operation simplifies the code very much, many thanks ;) On Tue, Jun 6, 2017 at 7:44 AM, David Winsemius <dwinsemius at comcast.net> wrote: > > > On Jun 6, 2017, at 4:01 AM, Jim Lemon <drjimlemon at gmail.com> wrote: > > > > Hi Bogdan, > > Kinda messy, but: > > > > N <-

Simple matrix indexing suffices without any fancier functionality. ## First convert M and N to character vectors -- which they should have been in the first place! M <- sort(as.character(M[,1])) N <- sort(as.character(N[,1])) ## This could be a one-liner, but I'll split it up for clarity. res <-matrix(NA, length(M),length(N),dimnames = list(M,N)) res[as.matrix(C[,2:1])] <-

Dear all, please could you advise on the R code I could use in order to do the following operation : a. -- I have 2 lists of "genome coordinates" : a list is composed by numbers that represent genome coordinates; let's say list N : n1 n2 n3 n4 and a list M: m1 m2 m3 m4 m5 2 -- and a data frame C, where for some pairs of coordinates (n,m) from the lists above, we have a

Hi all, I am sorry to fill your inbox mail with a naive question, although I would really appreciate your opinion. I am looking for a R function that takes a set of aligned sequences, and transforms a position frequency matrix into a position weight matrix. Thanks a lot. -- bogdan [[alternative HTML version deleted]]

I would appreciate please a suggestion on how to do the following : i'm working with a dataframe in R that contains in a specific column multiple gene names, eg : > df.sample.gene[15:20,2:8] Chr Start End Ref Alt Func.refGene Gene.refGene284 chr2 16080996 16080996 C T ncRNA_exonic GACAT3448 chr2 113979920 113979920 C T ncRNA_exonic LINC01191,LOC100499194465

This sounds like an operating system specific question, in that "submit the R script to a PBS HPC scheduler" would be the kind of action that would run R with very different environment variables and possibly different access credentials than your usual interactive terminal. A thorough reading of the "Installation and Administration Guide" and some study of your HPC

Dear all, I would appreciate please a piece of help regarding the use of acast/dcast functions in reshape2 package. Specifically, I'm working with a data frame, that has information about SAMPLE, GENE, and TYPE of MUTATION (as shown below): Sample Gene Type 22M AEBP1 SNV 17M AEBP1 SNV 22M ATR INDEL 22M ATR SNV 11M BTK SNV 11M BTK

Hi, The problem is most likely, you need to call a R CMD BATCH with your arguments and the R-script inside of a shell script that you submit to your qsub. Unfortunately we don't use qsub anymore so can't test it, but it should be as follows: R-script eg. test.R: > ##First read in the arguments listed at the command line > args=(commandArgs(TRUE)) > > ##args is now a list of

Reproducible example, please. -- In particular, what exactly does C look ilike? (You should know this by now). -- Bert Bert Gunter "The trouble with having an open mind is that people keep coming along and sticking things into it." -- Opus (aka Berkeley Breathed in his "Bloom County" comic strip ) On Mon, Jun 5, 2017 at 6:45 PM, Bogdan Tanasa <tanasa at gmail.com>

Dear all, would appreciate a suggestion about the following situation : I am running a script in R, and shall i execute it in the terminal, step by step, it works fine. however, if i do source ("script.R"), it does not complete and I am getting the error : "Can only modify plain character vectors." what may go wrong ? thank you for your help, -- bogdan [[alternative HTML

Hello I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")

Hi, I want to analyse DNA sequence data (mtDNA) in R as in calculate Fst, Heterozygosity and such summary statistics. Package Adagenet converts the DNA sequence into retaining only retaining the polymorphic sites and then calcuates Fst.. but is there any other way to do this? I mean analyse the DNA sequence as it is.. and calculate the statistics? Thanks! [[alternative HTML version deleted]]