similar to: Number with fixed digit length - zero fill-up

Hi, In Rcpp, we now have a "Function" class to encapsulate functions (they cover all three kinds, but this may change). To call the function, what we do is generate a call with the function as the first node and then evaluate the call. SEXP stats = PROTECT( R_FindNamespace( mkString( "stats") ) ); SEXP rnorm = PROTECT( findVarInFrame( stats, install( "rnorm") ) )

I have 6 or 7 nice constants (for example 1852 meters per nautical mile) I would like to have available to 4 or 5 functions in an R package. In C this would just be a header .h file and I would just "include" I am stuck trying to figure out how to create something like a C header file for an R package. Any ideas?

Un texte encapsul? et encod? dans un jeu de caract?res inconnu a ?t? nettoy?... Nom : non disponible URL : <https://stat.ethz.ch/pipermail/r-help/attachments/20100114/da4bc580/attachment.pl>

Hello, Could someone tell me, how can I select from a dataframe only those columns whose names contain a certain text? For example, if the column names are "Bond1.Creditclass","Bond1.Price","Bond2.Creditclass","Bond2.Price", how do I select only the columns corresponding to Bond1? Thanks a lot, Mihai [[alternative HTML version deleted]]

Hello there, I want to create a string from strings and numbers, here is my code: str <- "name" & toString(20) but it returns me this error: Error in toString(20) : could not find function ".jcall" what did I do wrong? I couldn't find this error anywhere... -- View this message in context: http://n4.nabble.com/Error-with-toString-tp1290327p1290327.html Sent from

Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context:

Hi the list, Is there a way to give a matrix to a C function, and then to use it as a matrix ? I write a function to print a matrix, but I use it as a vector : 1. void printMatrix(double *mTraj,int *nbCol, int *nbLigne){ 2. int i=0,j=0; 3. for(i=0 ; i < *nbLigne ; i++){ 4. for(j=0 ; j < *nbCol ; j++){ 5. Rprintf(" %f",mTraj[i * *nbCol + j]); 6. } 7.

Hi the list, I need to write some efficient distances function, so I read the code for the Euclidean distance. I do not understand the purpose of the line 11 : if x[i] and y[i] are not NA (line 9), can dev be NA ? Christophe #define both_FINITE(a,b) (R_FINITE(a) && R_FINITE(b)) #define both_non_NA(a,b) (!ISNAN(a) && !ISNAN(b)) 1. static double R_euclidean2(double *x, double

I have been working on an R package that calls C code using .C(). I recently started including some functions from the GNU Scientific Library in my code. The code runs fine on my machine when not wrapped in the package. But I get the following error from "R CMD check" * checking whether the package can be loaded ... ERROR Loading required package: splancs Loading required package: sp

Hello All, I am trying to create a column of weights based off of factor levels from another column. I am using the weights to calculate L scores. Here is an example where the first column are scores, the second is my "factor" and the third I want to be a column of weights. I can do what I want with an ifelse statement (see below), but I am wondering if anyone knows of a cleaner way

Dear R-help members, I'm processing a large amount of MODIS data where quality assessment information is stored as an integer value for each pixel. I have to converted this number to an 8 digit binary flag to get access to the stored quality code (e.g. in2bin(165,8) = 1 0 1 0 0 1 0 1). Unfortunately, I did not manage to find a package providing a fast function to do so. I need to run

Could somebody let me know if there is nested name space supported? For example, is it possible to define a function in the name space 'nested_namespace' which is nested in the name space 'some_namespace'? some_namespace:::nested_namespace:::a_function() I checked Section 1.6 of R-exts.pdf. It seems that nested namespace is not supported, right?

Hi all, Is there a fast way to determine the number of lines in a file? I'm looking for something like count.lines analogous to count.fields. Hadley -- http://had.co.nz/

Hi, Why can't I pass an expression to `within' by way of textual input to the 'parse' function? e.g., > x <- data.frame(a=1:5,b=LETTERS[1:5]) > x a b 1 1 A 2 2 B 3 3 C 4 4 D 5 5 E > within(x, parse(text="a<-a*10; b<-2:6")) a b 1 1 A 2 2 B 3 3 C 4 4 D 5 5 E > within(x, parse(text="a<-a*10; b<-2:6")[[1]]) a b 1 1 A 2 2 B 3

Hi, I am trying to implement ogg vorbis real time decoder on SHARC ADSP 21364 processor. I am writing my own version of the decoder using the documentation vorbis_I_spec.pdf from xiph.org. However I am facing certain hurdles in floor curve decoding during audio packet decode. In the spec it says that [cval] = read from packet using codebook number [so and so] in *scalar context*.(page no 43).

Hello, I've been trying to make LinkingTo work when the package linked to has c++ code. I've put dumb packages to illustrate this emails here ; http://addictedtor.free.fr/misc/linkingto Package A defines this C++ class: class A { public: A() ; ~A() ; SEXP hello() ; } ; Package B has this function : SEXP say_hello(){ A a ; return a.hello() ; } headers of package A are copied

Hi all, I have a csv file containing words with *UNPRINTABLE ASCII* characters (described in the following table). Are there any viable method in eliminating these characters? I realise that *EXTENDED ASCII* characters (i.e , ¡, ¢, £, ¤ etc) can be removed or replaced via *"gsub"* or *"gregexpr"* functions. But am not certain with the *UNPRINTABLE ASCII* characters. Your

Hi there- What''s the easiest/most efficient way to perform a zerofill in Ruby? i.e. Given the value ''val'', I would like to do something like: val = 43 puts val.zerofill(8) ---> "00000043" gsub? sprintf of some sort? Jake -- Posted via http://www.ruby-forum.com/.

Even though it seems dovecot (using 2.2.33.1) supports haproxy's send-proxy-v2, it seems to lack send-proxy-v2-ssl (which also sends client's ssl state). It would be a nice feature for the backend server to identify clients so one wouldn't have to use disable_plaintext_auth on a production environment. --- haproxy.cfg frontend pop3 bind [::]:110 v4v6 bind

Hello - I need to read in some tables that are embedded within data files like this: line 1 line 2 data table 01000 10110 00011 end table line 3 line 4 Is there any way to read just the data by telling an input device to start reading when it encounters the keyword "data table" and stop reading at "end table"? Thanks in advance, Jesse -- View this message in context: