similar to: Error with toString

Hi, In Rcpp, we now have a "Function" class to encapsulate functions (they cover all three kinds, but this may change). To call the function, what we do is generate a call with the function as the first node and then evaluate the call. SEXP stats = PROTECT( R_FindNamespace( mkString( "stats") ) ); SEXP rnorm = PROTECT( findVarInFrame( stats, install( "rnorm") ) )

I have 6 or 7 nice constants (for example 1852 meters per nautical mile) I would like to have available to 4 or 5 functions in an R package. In C this would just be a header .h file and I would just "include" I am stuck trying to figure out how to create something like a C header file for an R package. Any ideas?

Un texte encapsul? et encod? dans un jeu de caract?res inconnu a ?t? nettoy?... Nom : non disponible URL : <https://stat.ethz.ch/pipermail/r-help/attachments/20100114/da4bc580/attachment.pl>

Hello, Could someone tell me, how can I select from a dataframe only those columns whose names contain a certain text? For example, if the column names are "Bond1.Creditclass","Bond1.Price","Bond2.Creditclass","Bond2.Price", how do I select only the columns corresponding to Bond1? Thanks a lot, Mihai [[alternative HTML version deleted]]

Dear R-help members, I'm quite new to R and I apologize for my basic question, but I haven't been able to find a solution yet. I try to interpret vector entries as a binary code, but unfortunately every first digit which is zero disappears. So how can I set any number (e.g. x = 10110) to a 8-digit zero fill-up (x = 00010110) in order to address digit indices? Or other way round, how

Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context:

Hi the list, Is there a way to give a matrix to a C function, and then to use it as a matrix ? I write a function to print a matrix, but I use it as a vector : 1. void printMatrix(double *mTraj,int *nbCol, int *nbLigne){ 2. int i=0,j=0; 3. for(i=0 ; i < *nbLigne ; i++){ 4. for(j=0 ; j < *nbCol ; j++){ 5. Rprintf(" %f",mTraj[i * *nbCol + j]); 6. } 7.

Hi the list, I need to write some efficient distances function, so I read the code for the Euclidean distance. I do not understand the purpose of the line 11 : if x[i] and y[i] are not NA (line 9), can dev be NA ? Christophe #define both_FINITE(a,b) (R_FINITE(a) && R_FINITE(b)) #define both_non_NA(a,b) (!ISNAN(a) && !ISNAN(b)) 1. static double R_euclidean2(double *x, double

I have been working on an R package that calls C code using .C(). I recently started including some functions from the GNU Scientific Library in my code. The code runs fine on my machine when not wrapped in the package. But I get the following error from "R CMD check" * checking whether the package can be loaded ... ERROR Loading required package: splancs Loading required package: sp

Hello All, I am trying to create a column of weights based off of factor levels from another column. I am using the weights to calculate L scores. Here is an example where the first column are scores, the second is my "factor" and the third I want to be a column of weights. I can do what I want with an ifelse statement (see below), but I am wondering if anyone knows of a cleaner way

Hi, I want to save a RWeka model into a file, in order to retrive it latter with a load function. See this example: library(RWeka) NB <- make_Weka_classifier("weka/classifiers/bayes/NaiveBayes") model<-NB(formula,data=data,...) # does not run but you get the idea save(model,file="model.dat") # simple save R command # ... load("model.dat") # load the model

Hi, I am using R 1.5.1 under Windows 2000. I have a problem with the function toString: It seems not to work for longer vectors as expressions. This example works well: q1<-expression(c(1,2,3,4,5,6,7,8,9,10,11,12,13,14,15)) toString(q1) I get: "c(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15)" => OK But this one does not:

Hi all, Is there a fast way to determine the number of lines in a file? I'm looking for something like count.lines analogous to count.fields. Hadley -- http://had.co.nz/

Hola. En mi caso, no he podido resolver los problemas con el Java para usar XLConnect, que en los papeles me parece el mejor. Supongo que algo de la arquitectura del sistema o bien de la relación entre el Java, el R y el RStudio. Así que utilizo library(openxlsx) write.xlsx(datos, file = "EDA1.xlsx") #donde datos es el objeto que quiero guardar. Requiere instalar el RTools, según tipo y

Hi all, I got a problem with * "toString()"* function its behaving odd in some times most of the times its giving correct results but in peculier cases its giving results like *"愭]"* especially while i am working with c# +R-project thats also after getting some error like after trying to caliculate "*mean("NA")" * can any one help me why its

Could somebody let me know if there is nested name space supported? For example, is it possible to define a function in the name space 'nested_namespace' which is nested in the name space 'some_namespace'? some_namespace:::nested_namespace:::a_function() I checked Section 1.6 of R-exts.pdf. It seems that nested namespace is not supported, right?

Dear R-help Listers, I am curious if there is some (hopefully easy) way to change the number of characters that can be converted to a single string via any of deparse, as.character or toString. It seems that the limit is 500 for all of these. I saw a previous post where Prof. Ripley suggested that it was a "trivial" change in the R internals to change as.character's limit from 60

Hi! I wonder if llvm::APFloat::toString() can be const since it should not modify the APFloat. -Jochen

Dear List, Java Exception error while reading large data in R from DB using RJDBC. I am trying to read large data from DB table(Vectorwise), using RJDBC connection. I have tested the connection with small size data and was able to fetch DB tables using same connection(conn as in my code). Please suggest where am i going wrong or alternate option to solve such issues while reading large DB

Dear all, I am facing a problem with running a script that i have written in R and i hope you can help me spot which exactly is the problem and how i can solve it. The error I get is the following: ---- Error in .jcheck(silent = FALSE) : Java Exception <no description because toString() failed>.jcall(row[[ir]], "Lorg/apache/poi/ss/usermodel/Cell;", "createCell",