similar to: header files for R packages

Hi, In Rcpp, we now have a "Function" class to encapsulate functions (they cover all three kinds, but this may change). To call the function, what we do is generate a call with the function as the first node and then evaluate the call. SEXP stats = PROTECT( R_FindNamespace( mkString( "stats") ) ); SEXP rnorm = PROTECT( findVarInFrame( stats, install( "rnorm") ) )

Un texte encapsul? et encod? dans un jeu de caract?res inconnu a ?t? nettoy?... Nom : non disponible URL : <https://stat.ethz.ch/pipermail/r-help/attachments/20100114/da4bc580/attachment.pl>

Hello, Could someone tell me, how can I select from a dataframe only those columns whose names contain a certain text? For example, if the column names are "Bond1.Creditclass","Bond1.Price","Bond2.Creditclass","Bond2.Price", how do I select only the columns corresponding to Bond1? Thanks a lot, Mihai [[alternative HTML version deleted]]

Dear R-help members, I'm quite new to R and I apologize for my basic question, but I haven't been able to find a solution yet. I try to interpret vector entries as a binary code, but unfortunately every first digit which is zero disappears. So how can I set any number (e.g. x = 10110) to a 8-digit zero fill-up (x = 00010110) in order to address digit indices? Or other way round, how

Hello there, I want to create a string from strings and numbers, here is my code: str <- "name" & toString(20) but it returns me this error: Error in toString(20) : could not find function ".jcall" what did I do wrong? I couldn't find this error anywhere... -- View this message in context: http://n4.nabble.com/Error-with-toString-tp1290327p1290327.html Sent from

Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context:

Hi the list, Is there a way to give a matrix to a C function, and then to use it as a matrix ? I write a function to print a matrix, but I use it as a vector : 1. void printMatrix(double *mTraj,int *nbCol, int *nbLigne){ 2. int i=0,j=0; 3. for(i=0 ; i < *nbLigne ; i++){ 4. for(j=0 ; j < *nbCol ; j++){ 5. Rprintf(" %f",mTraj[i * *nbCol + j]); 6. } 7.

Hi the list, I need to write some efficient distances function, so I read the code for the Euclidean distance. I do not understand the purpose of the line 11 : if x[i] and y[i] are not NA (line 9), can dev be NA ? Christophe #define both_FINITE(a,b) (R_FINITE(a) && R_FINITE(b)) #define both_non_NA(a,b) (!ISNAN(a) && !ISNAN(b)) 1. static double R_euclidean2(double *x, double

I have been working on an R package that calls C code using .C(). I recently started including some functions from the GNU Scientific Library in my code. The code runs fine on my machine when not wrapped in the package. But I get the following error from "R CMD check" * checking whether the package can be loaded ... ERROR Loading required package: splancs Loading required package: sp

> > I might as well add to the offtopic thread... why are natuical miles longer than "regular" miles? Andrew A nautical mile is 1 minute of latitude. -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.digium.com/pipermail/asterisk-users/attachments/20040112/6658a905/attachment.htm

Hello All, I am trying to create a column of weights based off of factor levels from another column. I am using the weights to calculate L scores. Here is an example where the first column are scores, the second is my "factor" and the third I want to be a column of weights. I can do what I want with an ifelse statement (see below), but I am wondering if anyone knows of a cleaner way

Here's the latest batch of words to get shipped out to Allison Smith. Please submit reasonably small changes to me by tomorrow 10:00 AM Eastern time, and I'll add them. As usual, donations to what will be a ~$110 USD expense would be appreciated, as I am paying for this round out of my pocket. Please send to paypal address "jtodd@loligo.com". I did not include all

Does anyone have any recommendations for working with zip code distance ranges? I need to calculate the distances between US zip codes. Thanks! -------------- next part -------------- An HTML attachment was scrubbed... URL: http://wrath.rubyonrails.org/pipermail/rails/attachments/20060711/f133d7de/attachment-0001.html

Could somebody let me know if there is nested name space supported? For example, is it possible to define a function in the name space 'nested_namespace' which is nested in the name space 'some_namespace'? some_namespace:::nested_namespace:::a_function() I checked Section 1.6 of R-exts.pdf. It seems that nested namespace is not supported, right?

With good and faithful python remote database queries look something like this: url.urlopen("username/pssword at host",query) where query is something like "select * from table where ...." Does R support queries on remote hosts with username and password? What does a simple example look like? Thank you.

Hi all, Is there a fast way to determine the number of lines in a file? I'm looking for something like count.lines analogous to count.fields. Hadley -- http://had.co.nz/

I see Rmath.h in include. Why can't I find libRmath.a and/or libRmath.so? -- View this message in context: http://r.789695.n4.nabble.com/where-is-libRmath-a-libRmath-so-tp2216048p2216048.html Sent from the R devel mailing list archive at Nabble.com.

So, per the discussion last week and generous donations, we have some new sound files with which to work. The sounds are located in: http://www.loligo.com/asterisk/sounds/ For those of you who just want to download the _new_ sounds, please fetch: http://www.loligo.com/asterisk/sounds/20040117.newsounds.tar All of the sounds in that tarball are also in the main ../sounds/ directory in

Hi the list When two setGeneric occurs on the same function, the second erage the first and erase all the function previously define. Is it possible to prevent that ? Is it possible to declare a setGeneric that can not be erased later ? Something like the |sealed for setMethod...| || |Thanks| || Christophe

Hello all, I'm having a problem when overwriting the '<-' function and was told I'd better post it here for help. The reason why I need to overwrite it is complicated and not easy to tell in a few words; but this seems the only clean option other than hacking R's core source code. My code looks like: # in .onLoad of a package; or if you want to test, put it in a function