similar to: Logical function

Hi, In Rcpp, we now have a "Function" class to encapsulate functions (they cover all three kinds, but this may change). To call the function, what we do is generate a call with the function as the first node and then evaluate the call. SEXP stats = PROTECT( R_FindNamespace( mkString( "stats") ) ); SEXP rnorm = PROTECT( findVarInFrame( stats, install( "rnorm") ) )

I have 6 or 7 nice constants (for example 1852 meters per nautical mile) I would like to have available to 4 or 5 functions in an R package. In C this would just be a header .h file and I would just "include" I am stuck trying to figure out how to create something like a C header file for an R package. Any ideas?

Hello, Could someone tell me, how can I select from a dataframe only those columns whose names contain a certain text? For example, if the column names are "Bond1.Creditclass","Bond1.Price","Bond2.Creditclass","Bond2.Price", how do I select only the columns corresponding to Bond1? Thanks a lot, Mihai [[alternative HTML version deleted]]

Dear R-help members, I'm quite new to R and I apologize for my basic question, but I haven't been able to find a solution yet. I try to interpret vector entries as a binary code, but unfortunately every first digit which is zero disappears. So how can I set any number (e.g. x = 10110) to a 8-digit zero fill-up (x = 00010110) in order to address digit indices? Or other way round, how

Hello there, I want to create a string from strings and numbers, here is my code: str <- "name" & toString(20) but it returns me this error: Error in toString(20) : could not find function ".jcall" what did I do wrong? I couldn't find this error anywhere... -- View this message in context: http://n4.nabble.com/Error-with-toString-tp1290327p1290327.html Sent from

Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context:

Hi the list, Is there a way to give a matrix to a C function, and then to use it as a matrix ? I write a function to print a matrix, but I use it as a vector : 1. void printMatrix(double *mTraj,int *nbCol, int *nbLigne){ 2. int i=0,j=0; 3. for(i=0 ; i < *nbLigne ; i++){ 4. for(j=0 ; j < *nbCol ; j++){ 5. Rprintf(" %f",mTraj[i * *nbCol + j]); 6. } 7.

Hi the list, I need to write some efficient distances function, so I read the code for the Euclidean distance. I do not understand the purpose of the line 11 : if x[i] and y[i] are not NA (line 9), can dev be NA ? Christophe #define both_FINITE(a,b) (R_FINITE(a) && R_FINITE(b)) #define both_non_NA(a,b) (!ISNAN(a) && !ISNAN(b)) 1. static double R_euclidean2(double *x, double

I have been working on an R package that calls C code using .C(). I recently started including some functions from the GNU Scientific Library in my code. The code runs fine on my machine when not wrapped in the package. But I get the following error from "R CMD check" * checking whether the package can be loaded ... ERROR Loading required package: splancs Loading required package: sp

Hello All, I am trying to create a column of weights based off of factor levels from another column. I am using the weights to calculate L scores. Here is an example where the first column are scores, the second is my "factor" and the third I want to be a column of weights. I can do what I want with an ifelse statement (see below), but I am wondering if anyone knows of a cleaner way

Could somebody let me know if there is nested name space supported? For example, is it possible to define a function in the name space 'nested_namespace' which is nested in the name space 'some_namespace'? some_namespace:::nested_namespace:::a_function() I checked Section 1.6 of R-exts.pdf. It seems that nested namespace is not supported, right?

Hi all, Is there a fast way to determine the number of lines in a file? I'm looking for something like count.lines analogous to count.fields. Hadley -- http://had.co.nz/

Full_Name: Alex Deckmyn Version: 2.4.0 OS: linux Submission from: (NULL) (193.190.63.62) specifying the "right" option in hist results in a warning when plot=F. The option is taken into account correctly, but a warning is issued anyway. When plot=T there is no warning. > hist(c(1,1.5),breaks=0:4)$counts [1] 1 1 0 0 > hist(c(1,1.5),breaks=0:4,right=T)$counts [1] 1 1 0 0 >

I'm solving 4 complex equations simultaneously. Code is below. The code returns only zero's for the solution though there should also be a non-zero result. I'm pretty confident that the equations are correct because they are straight from a published paper and I checked them pretty thoroughly. The parameter values I used are from the published paper as well. Any suggestions for how

Full_Name: Alex Deckmyn Version: 1.5.1 OS: Linux Mandrake 7.0 Submission from: (NULL) (193.190.63.62) A short function in a library contains the complex number -2i : phihat <- function(x) { x+ (-2i) } If i read the source file with source("phihat") this works fine. If I include it as a function in a library and read it with library(test), the function is still read

Hello, I've been trying to make LinkingTo work when the package linked to has c++ code. I've put dumb packages to illustrate this emails here ; http://addictedtor.free.fr/misc/linkingto Package A defines this C++ class: class A { public: A() ; ~A() ; SEXP hello() ; } ; Package B has this function : SEXP say_hello(){ A a ; return a.hello() ; } headers of package A are copied

Dear Bert, Thank you so much for your kind and valuable feedback. I tried finding the starting values using the approach you mentioned, then did the following to fit the nonlinear regression model: nlregmod2 <- nls(y ~ theta1 - theta2*exp(-theta3*x), start = list(theta1 = 0.37, theta2 = exp(-1.8), theta3 =

Estimados Usuarios-R: Estoy convirtiendo un programa en Matlab a R. El original lo saqu de: Lai, M., & Poltera, Y. (2009). Lecture with computer exercises: Modelling and simulating social systems with matlab. Tech. rep., Swiss Federal Institute of Technology (December 2009). 27. Ahora estoy convirtiendo la siguiente funcin: function sizes = gridsizes(N,varargin) % gridsizes(N) calculates

Could some kindly tell me if I am supposed to be getting the same test statistic value with var.equal=TRUE and var.equal=FALSE in t.test ? set.seed(1066) x1 <- rnorm(50) x2 <- rnorm(50) t.test(x1, x2, var.equal=FALSE)$statistic # 0.5989774 t.test(x1, x2, var.equal=TRUE)$statistic # 0.5989774 ??? Here are my own calculations that shows that perhaps the result when var.equal=TRUE is

Hi R lovers I would like to know how to step to the next line in the R console editor without breaking the continuity of my code more clearly : if for example I write a function, so far i have to write the all code inside on the same line wich may become obscure as the function is more and more complex. I would like to do like in the example of the manuels: >twosam <- function(y1, y2) {