similar to: question on 'within' and 'parse' commands

[Disclaimer: what is below reflects my understanding from reading the R source, others will correct where deemed necessary] On 1/2/10 12:00 PM, r-devel-request at r-project.org wrote: > > Hello, > > We are currently making lots of changes to Rcpp (see the open Rcpp > mailing list if interested [1] in the details). > > We are now using [2] R_PreserveObject and R_ReleaseObject

Could somebody let me know if there is nested name space supported? For example, is it possible to define a function in the name space 'nested_namespace' which is nested in the name space 'some_namespace'? some_namespace:::nested_namespace:::a_function() I checked Section 1.6 of R-exts.pdf. It seems that nested namespace is not supported, right?

I noticed some odd behavior when I transpose a data frame containing NA's. It seems to cast all the elements as "character" including the NA's. Bug? > t(data.frame(x=1:10,y=1:10,z=rep(NA,10))) 1 2 3 4 5 6 7 8 9 10 x " 1" " 2" " 3" " 4" " 5" " 6"

Greetings, Quick Summary: How does R function non-interactively? I can't print graphics to an X11 window. I set up what appears to be called a "noninteractive" R session using the Perl code at the end of this message. Everthing seems to work fine as written. I get a nice postscript file with my graphics. However, I would like to display X11 R-graphics for the Perl-script

With R 1.5.1 (Linux/Intel), I noticed that one of my large functions (>3000 lines) can no longer be parsed. Somewhere around 2800 lines, R will segfault when I `eval(parse(file="..."))' the function. I can parse the lines after around line 2800 by themselves (i.e., cut and pasted). Is there some new limit on the size of R functions? --

I have a confusing problem with getting the form `x - trunc(x)' to be exactly zero when `x' is an integer. It only seems to occur inside of a function. [R-1.6.0 on Linux/Intel] I have a function to return the highest precision digit of values in `x': prec<-function(x){ init <- trunc(log10(max(x))) y <- x - trunc(x) while (any(y > 0)) { init <- init - 1 x1

I just tried to batch-start rgui.exe (not rterm.exe) in a way, that it read.table()s data from a file with changing filename. As I understand no command line parameters are available for that, so instead I tried to pass the filename to an approbriate .RProfile, which works roughly, BUT ## this is my %R_USER%\.RProfile im <- read.table("d:/temp/im/temp.csv", header=TRUE,

Hi, In Rcpp, we now have a "Function" class to encapsulate functions (they cover all three kinds, but this may change). To call the function, what we do is generate a call with the function as the first node and then evaluate the call. SEXP stats = PROTECT( R_FindNamespace( mkString( "stats") ) ); SEXP rnorm = PROTECT( findVarInFrame( stats, install( "rnorm") ) )

Greetings, I'm having trouble finding a simple way to calculate a weighted histogram where there may be zero raw counts in a given interval. Given equal-length vectors of data 'data' and weights 'w', and breaks (intervals) for the histogram, I calculate a weighted histogram as follows (see MASS's 'truehist' for an unweighted histogram): bin <- cut(data,

Hello, We are currently making lots of changes to Rcpp (see the open Rcpp mailing list if interested [1] in the details). We are now using [2] R_PreserveObject and R_ReleaseObject to manage garbage collection instead of the PROTECT/UNPROTECT dance. This seems to work well, but I was wondering if there was documentation about it. In particular, if we preserve the same SEXP twice (or more),

Dear all, I'm a beginner in spatial regression, therefore, excuse me in advance for the stupid question. I'm using the function Tps of field library. As I read in help, the assumed model for this regression is additive Y = f(X) + e where f(X) is a d dimensional surface. I have understood that d in not an argument to specify in Tps(x, Y, ...). How can I obtain d ? Thanks a lot.

I have 6 or 7 nice constants (for example 1852 meters per nautical mile) I would like to have available to 4 or 5 functions in an R package. In C this would just be a header .h file and I would just "include" I am stuck trying to figure out how to create something like a C header file for an R package. Any ideas?

Un texte encapsul? et encod? dans un jeu de caract?res inconnu a ?t? nettoy?... Nom : non disponible URL : <https://stat.ethz.ch/pipermail/r-help/attachments/20100114/da4bc580/attachment.pl>

Hello, Could someone tell me, how can I select from a dataframe only those columns whose names contain a certain text? For example, if the column names are "Bond1.Creditclass","Bond1.Price","Bond2.Creditclass","Bond2.Price", how do I select only the columns corresponding to Bond1? Thanks a lot, Mihai [[alternative HTML version deleted]]

Dear R-help members, I'm quite new to R and I apologize for my basic question, but I haven't been able to find a solution yet. I try to interpret vector entries as a binary code, but unfortunately every first digit which is zero disappears. So how can I set any number (e.g. x = 10110) to a 8-digit zero fill-up (x = 00010110) in order to address digit indices? Or other way round, how

Hello there, I want to create a string from strings and numbers, here is my code: str <- "name" & toString(20) but it returns me this error: Error in toString(20) : could not find function ".jcall" what did I do wrong? I couldn't find this error anywhere... -- View this message in context: http://n4.nabble.com/Error-with-toString-tp1290327p1290327.html Sent from

Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context:

Hi the list, Is there a way to give a matrix to a C function, and then to use it as a matrix ? I write a function to print a matrix, but I use it as a vector : 1. void printMatrix(double *mTraj,int *nbCol, int *nbLigne){ 2. int i=0,j=0; 3. for(i=0 ; i < *nbLigne ; i++){ 4. for(j=0 ; j < *nbCol ; j++){ 5. Rprintf(" %f",mTraj[i * *nbCol + j]); 6. } 7.

Hi the list, I need to write some efficient distances function, so I read the code for the Euclidean distance. I do not understand the purpose of the line 11 : if x[i] and y[i] are not NA (line 9), can dev be NA ? Christophe #define both_FINITE(a,b) (R_FINITE(a) && R_FINITE(b)) #define both_non_NA(a,b) (!ISNAN(a) && !ISNAN(b)) 1. static double R_euclidean2(double *x, double

I have been working on an R package that calls C code using .C(). I recently started including some functions from the GNU Scientific Library in my code. The code runs fine on my machine when not wrapped in the package. But I get the following error from "R CMD check" * checking whether the package can be loaded ... ERROR Loading required package: splancs Loading required package: sp