similar to: Axes origins and labeling

I have long axis labels (8units) on the x axis and 2 unit number labels on the y axis. I need to move the x axis title without moving the y axis title. I have used mgp=c(title, label and line), but mgp moves both the x and y titles. The following puts the y axis title way way out to the left. Anyone know how to move just the x axis. X11() conif<-c("Control", "Switched

Thank you ahead of time for help with this. I have two matrices X [,1] [,2] [,3] [,4] [,5] [,6] [1,] 660 693.00 726.0 759.00 792.0 825.00 [2,] 548 575.40 602.8 630.20 657.6 685.00 [3,] 676 709.80 743.6 777.40 811.2 845.00 [4,] 763 801.15 839.3 877.45 915.6 953.75 [5,] 768 806.40 844.8 883.20 921.6 960.00 [6,] 692 726.60 761.2 795.80 830.4 865.00 [7,] 657 689.85 722.7

R users, This should be simple, but I cannot figure it out. I import test.csv, then create a subset for "brook_dis". When I plot (week, R) I get a nice boxplot, but along the x axis, there are weeks a, b, c along with h and nh. Thank you ahead of time. keith rm(list=ls()) cond.exp1<-read.csv("condition/test.csv",header=TRUE) sub<-subset(cond.exp1,

asterisk-users-bounces@lists.digium.com wrote: > In the following setup: > call coming from a pstn line -> into FXO card -> asterisk -> SIP > phone > > i get an incredible loud echo in the SIP phone (about 0,5-1s) > (everything i speak into SIP phone microphone i hear in its > speaker). The person calling from PSTN is not getting any echo. Make sure you're not

Hi all and thanks in advance. I am regressing Time and Weight, and then predicting Weight at different Time. The format of the Time data is day/month/year. How can I get R to use time series data such as this? Keith -- M. Keith Cox, Ph.D. Alaska NOAA Fisheries, National Marine Fisheries Service Auke Bay Laboratories 17109 Pt. Lena Loop Rd. Juneau, AK 99801 Keith.Cox at noaa.gov marlinkcox at

Z is a matrix and when I run the following line, it creates a prediction estimate using each column, how can I get it an estimate for each individual number. I have tried changing Z to a data.frame, but this does not do it either. model.lm<-lm(w~x) pred.est <- predict.lm(model.lm, data.frame(x=Z)) Thanks in advance, keith -- Keith Cox, Ph.D. Sitka Sound Science Center Fisheries

Hi, I would like to add a color under a lm line and not the plotted line. Is this possible? In the example, I do not want the area under the curve red, but rather under the llm line. x=seq(0,5,len=100) y=-(x-5)^2 llm<-lm(y~x) plot(x,y) polygon(c(x,x[length(x)]), c(y, y[1]), col='red') abline(llm) keith -- M. Keith Cox, Ph.D. Alaska NOAA Fisheries, National Marine Fisheries Service

Dear R Users, close to the end of this I used wireframe to create a 3D plot from a matrix. The x and y axis tick labels (1-6) for each were created from the matrix being a 6X6 matrix. I need the axis tick labels to be the row and column headings which you can see in the output (mat.x). I have tried several work arounds, but they have not been successful. Thanks in advance. keith rm(list=ls())

Hello, hopefully simple question, but I cannot find the answer. I need to change the color from the standard default. Still want the scaled colors, but need different colors for different graphs. Code is: wireframe(z ~ y*x, mat.df, drape = TRUE, zlab = list("Water mass error (%)",rot=92), zlim=c(-50,180), xlab = list("Resistance error

I would like to create a point plot with the following two sets of points: #1 plot(Day,Total) and #2 (Day,cons_hat). Total is the actual value seen and cons-hat is a predicted value. If possible, I do not want to stack them as they are quite long. (FYI, I did use the reshape on a previous post, thanks, but this one is different). Day Tank Tanks Total cons_hat 1 a a4 5.651017 5.59

I'm struggling to configuring nut for MGE Pulsar Ellipse 800 (at least Ellipse 800) for two boxes - home firewall and file server. I'm using Debian 4.0 Etch, every one of them. I'm built (after some dangerouse experiments) a testing configuration, where boxes are plugged to line, server playing as a master, firewall as a slave, and UPS connected to an electric heater about 300 Wats (no

I need a two sample t.test between M and F. The data are arranged in one column, x. Cant seem to figure how to run a two sample t.test. Not really sure what this output is giving me, but there should be no difference between M and F in the example, but summary p-value indicates this. How can I run a two sample t.test with data in one column. x=rep(c(1,2,3,4),2)

Matt, I know you are probably busy with work, but I cannot help buy asking you these R questions. If it is bothersome, please let me know and I will stick with the R help... but I have two matrices X [,1] [,2] [,3] [,4] [,5] [,6] [1,] 660 693.00 726.0 759.00 792.0 825.00 [2,] 548 575.40 602.8 630.20 657.6 685.00 [3,] 676 709.80 743.6 777.40 811.2 845.00 [4,] 763 801.15 839.3

I would like to calculate a first and second derivative and am having problems finding a simple solution. My syntax may be off as I am not a mathematician, so pardon ahead of time. data: t<-seq(0,4, by=.1) The function is: H(t) = t^3-6*t^2+5*t + 30 from here I plot the curve: plot(x,y ,xlab="x-values", ylab="f(x)", type="l") But would like to similarly plot the

OK, this is very elementary, but I need help. I have looked in Verzani, past postings etc. Problem: I need to subtract the "length" date between "h4" and "a3" #which would be 4-1 I would rather not convert the two columns into four columns (with headings being "a3","a4","c4","h4"). DF <- data.frame(length=c(1,2,3,4),

This data are kilojoules of energy that are consumed in starving fish over a time period (Days). The KJ reach a lower asymptote and level off and I would like to use a non-linear plot to show this leveling off. The data are noisy and the sample sizes not the largest. I have tried selfstarting weibull curves and tried the following, both end with errors. Days<-c(12, 12, 12, 12, 22, 22, 22,

Does anyone know of a cross browser solution to print a page/url after a user clicks a button? Currently, I''m using a "hidden" iframe to do my bidding. But from my experience, IE requires that the iframe''s src attribute be set initially to the url, in order for the page to open properly. I wasn''t able to add the iframe to the page dynamically, either. So

Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context:

My data is the following: Time Resistance Temperature 5 2000 4 10 2200 8 15 2500 14 20 2900 20 25 3000 29 30 3100 38 35 3500 46 40 3800 47 45 3900 50 50 4000 51 I would like to create a scatter plot with Time on the x axis, Resistance on the y axis and Temperature on a second y axis. I have tried Plot(Time,Resistance,ylim=range(0,4500)

Hello users, I have a Digium Te235 and asterisk 13 which have worked well with 1 carrier but we have failed to add a 2nd carrier. The second telco brings their E1 line over finer, terminated in a RAD modem and they give me ethernet to the E1 card. It's the first time i am having install such a solution, which ideally would be not a big problem. However, The physical layer has failed to