similar to: t.tests by unique groupes

I would like help with a "dial plan" that will do the following: I feel pretty good about each of the elements except; how to e-mail the recorded file to an e-mail address. Allow a caller to call into the system: 1. Answer 2. play a short pre defined greeting 3. Allow caller to enter "PIN" during the Item #2 greeting a. If the caller entered THE valid pin (1 system

hi all I have R object look like this: > spl $SB012XSB044 DPW Cross 1 66.6 SB012XSB044 2 96.5 SB012XSB044 3 78.8 SB012XSB044 4 68.6 SB012XSB044 5 62.0 SB012XSB044 6 72.1 SB044XSB012 7 72.2 SB044XSB012 8 69.6 SB044XSB012 9 87.9 SB044XSB012 10 84.4 SB044XSB012 11 51.9 SB044XSB012 12 65.5 SB044XSB012 $SB012XSB099 DPW Cross 13 100.9 SB012XSB099 14 44.4 SB012XSB099

Hello!!! I'm trying to do multiple ANOVA tests with R (testing the affect off different factors on the same response). As a result I get many ANOVA tables, and I want to extract a list of the "Pr(>F)" from all the tables. Maybe someone have an idea how to do this? Thanks Imri -- View this message in context:

Hi r-users, I want to use the sn package but I got the following message: > install.packages(repos=NULL,pkgs="c:\\Tinn-R\\sn_0.4-12.zip") Warning: package 'sn' is in use and will not be installed updating HTML package descriptions I did tried to do it a few times but it gives the same message.  ________________________________ From:

Hi, This is a very scary problem I have here. I use a precompiled 2.0.6 samba on my SGI IRIX 6.3 system. I also have smbpasswd file setup. When I tried to change the samba password using smbpasswd program ( from a non root account whic I use) I got an error messgae saying that it cannot change the password. My goodness, I found that the instead of changing password for my account smbpasswd

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

Dear List, I've been running a numerical simulation and I found this odd error in my code where the which command could not identify which rows of a column of data.frame were corresponding to the value 0.3. There are 7 unique values in this column (0.01,0.05,0.1,0.2,0.3,0.4,0.5), and this does not work only for 0.3. So I looked at the column and manually tried to use the which() command, and

Signed-off-by: Scott Seago <sseago at redhat.com> --- AUTHORS | 17 ++++++ README | 10 +++ conf/ovirt-agent | 12 ++++ conf/ovirt-db-omatic | 12 ++++ conf/ovirt-host-browser | 12 ++++

Hi all My data table (g) contains a continues data column (plant.height) and other columns (columns 8 to 57), each with number of levels of different factors. ANOVA test was done and the p-values were extracted as follos: a <- function(x) anova(lm(plant.height ~ x))$"Pr(>F)"[1] r<- apply(g[,8:57],2,a) If I try to do a Kruskal-Wallis test : kw <- function(x)