similar to: How to force aggregate to exclude NA ?

Displaying 20 results from an estimated 10000 matches similar to: "How to force aggregate to exclude NA ?"

2007 Jul 13
2
Suggestion to extend aggregate() to return multiple and/or named values
Hi all, This is my first post to the developers list. As I understand it, aggregate() currently repeats a function across cells in a dataframe but is only able to handle functions with single value returns. Aggregate() also lacks the ability to retain the names given to the returned value. I've created an agg() function (pasted below) that is apparently backwards compatible (i.e.
2006 Jun 30
2
aggregate data.frame by one column
Hi, everyone, I have a data.frame named "eva" like this: IND PARTNO VC1 EO1 EO2 EO3 EO4 EO5 114 114001 2 5 4 4 5 4 114 114001 2 4 4 4 4 4 114 114001 2 4 NA NA NA NA 112 112002 2 3 3 6 2 6 112 112002 2 1 1 3 4 4 112 112003 2 6 6 6 5 6 112 112003 2 5 7 6 6 6 112 112003 2 6 6 6 4 5 114 114004 2
2008 Jun 23
2
grouping values
I tried aggregate, apply etc, but can't get the right result. For example, m <- cbind(c(LETTERS[1:5]), c("aa", "bb", "cc", "aa", "cc")) [,1] [,2][1,] "A" "aa"[2,] "B" "bb"[3,] "C" "cc"[4,] "D" "aa"[5,] "E" "cc" how to obtain
2008 Jun 19
4
Any simple way to subset a vector of strings that do contain a particular substring ?
For example, strings <- c("aaaa", "bbbb","ccba"). How to get "aaaa", "bbbb" that do not contain "ba" ? _________________________________________________________________ [[alternative HTML version deleted]]
2008 Jul 31
4
Identifying common prefixes from a vector of words, and delete those prefixes
For example, c("dog.is.an.animal", "cat.is.an.animal", "rat.is.an.animal"). How can I identify the common prefix is ".is.an.animal" and delete it to give c("dog", "cat", "rat") ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]
2008 Jul 15
5
counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]
2008 Dec 03
2
Speeding up casting a dataframe from long to wide format
Hi, I am casting a dataframe from long to wide format. The same codes that works for a smaller dataframe would take a long time (more than two hours and still running) for a longer dataframe of 2495227 rows and ten different predictors. How to make it more efficient ? wer <- data.frame(Name=c(1:5, 4:5), Type=c(letters[1:5], letters[4:5]), Predictor=c("A", "A",
2008 Jun 10
2
Fast method to compute average values of duplicated IDs
Hi, How do I collapse (average in the simplest case) the values of those duplicated ids (i.e., 2, 5, 6, 9) to give a table of unique ids ? t <- cbind(id=c(1:10, 2,5,6,9), value=rnorm(14)) _________________________________________________________________ [[alternative HTML version deleted]]
2008 Sep 13
3
Beautify R scripts in microsoft word
I am generating a report containing several R scripts in the appendix. Is there any way to "beautify" the R source codes in microsoft word, similar to what we see in tinn-R ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]
2024 Dec 11
2
aggregate produces results in unexpected format
I am trying to use the aggregate function to run a function, catsbydat2, that produces the mean, minimum, maximum, and number of observations of the values in a dataframe, inJan2Test, by levels of the dataframe variable MyDay. The output should be in the form of a dataframe. #my code: # This function should process a data frame and return a data frame # containing the mean, minimum, maximum, and
2012 Sep 10
3
Plot not too dense line plot
Dear all, I am including in a plot 6 different lines (?lines) with 6 different line types. The problem is that I have so dense information that the line types are not visible any more.   In the code below myLength<-length(currentSet) plot(seq(from=1,to=myMax,length.out=myLength),currentSet, type="l",xlim=c(1,myMax),axes=F,...) the myLength is 100.000+ elements. I would like to ask
2008 Jul 08
4
Can R do this ?
I have a folder full of pngs and jpgs, and would like to consolidate them into a pdf with appropriate title and labels. Can this be done via R ? _________________________________________________________________ Easily publish your photos to your Spaces with Photo Gallery. [[alternative HTML version deleted]]
2009 Mar 30
3
Calculating First Occurance by a factor
I'm having difficulty finding a solution to my problem that without using a for loop. For the amount of data I (will) have, the for loop will probably be too slow. I tried searching around before posting and couldn't find anything, hopefully it's not embarrassingly easy. Consider the data.frame, Data, below Data Sub Tr IA FixInx FixTime p1 t1 1 1 200 p1 t1 2
2011 Mar 30
3
optim and optimize are not finding the right parameter
Dear all, I have a function that predicts DV based on one predictor pred: pred<-c(0,3000000,7800000,15600000,23400000,131200000) DV<-c(0,500,1000,1400,1700,1900) ## I define Function 1 that computes the predicted value based on pred values and parameters a and b: calc_DV_pred <- function(a,b) { DV_pred <- rep(0,(length(pred))) for(i in 1:length(DV_pred)){ DV_pred[i] <- a *
2011 Nov 20
2
Adding two or more columns of a data frame for each row when NAs are present.
I am fairly new to R and would like help with the problem below. I am trying to sum and count several rows in the data frame yy below. All works well as in example 1. When I try to add the columns, with an NA in Q21, I get as NA as mySum. I would like NA to be treated as O, or igored. I wrote a function to try to count an NA element as 0, Example 3 function. It works with a few warnings,
2009 Jan 06
2
Generating GUI for r-scripts
Hi, I have developed some scripts that basically ask for input tab-limited format files, do some processing, and output several pictures or csv. Now I need to have some gui to wrap on top of the scripts, so that end-users can select their input files, adjust some parameters for processing, and select output folder or filenames. Please advice me if there is any tools or project suitable for
2012 Jan 19
8
sumarizar
*Hola!!! resulta que tengo unos datos de divisas ordenados por fechas (días) los que he convertido a formato tipo YYYY-MM-DD donde DD siempre es 01:* * * * EUR.resto$date<-as.Date(EUR.resto$date) EUR.resto$mo <- substr(EUR.resto$date,6,7) EUR.resto$yr <- substr(EUR.resto$date, 1,4)
2007 Dec 16
2
question about the aggregate function with respect to order of levels of grouping elements
Hi, I am using aggregate() to add up groups of data according to year and month. It seems that the function aggregate() automatically sorts the levels of factors of the grouping elements, even if the order of the levels of factors is supplied. I am wondering if this is a bug, or if I missed something important. Below is an example that shows what I mean. Does anyone know if this is just the way
2009 Mar 20
4
how to make aggregation in R ?
Hi, I am trying to aggregate the sum of my test data.frame as follow: testDF <- data.frame(v1 = c("a", "a", "a", "a", "a", "b", "b", "b", "b", "b", "c", "c", "c", "c", "c", "d", "d", "d", "d",
2008 Oct 30
2
how to convert data from long to wide format ?
Given a dataframe m > m X Y V3 V4 1 1 A 0.5 1.2 2 1 B 0.2 1.4 3 2 A 0.1 0.9 How do I convert m to this with V4 as the cell values ? A B 1 1.2 1.4 2 0.9 NA