similar to: dev2bitmap: extra missing

Stefano, Thanks for the bug report. On 14 November 2008 at 14:35, Stefano Costa wrote: | Package: r-base-core | Version: 2.8.0-1 | Severity: normal | | As in subject. The bug is reproducible on my machine with these | commands: | | > x <- rnorm(100) | > plot(density(x)) | > dev2bitmap("density.png") | Error in paste(shQuote(gsexe), " -dNOPAUSE -dBATCH -q

Dear List, I am using the bioconductor package Category to do some gene enrichment analysis, and usually save my KEGGmnplot's using a dev2bitmap command. This has worked just fine, until suddenly earlier today I got this error-message: > dev2bitmap("04610_080721.jpg",type="jpeg", height = 10, width = 10, res = 200) Error in dev2bitmap("04610_CSF080721.jpg",

Hi, using too long pathnames for bitmap() crash R on WinXP. I've verified that this is the case with R version 2.4.1 Patched (2007-03-25 r40958) and R version 2.5.0 alpha (2007-03-30 r40957). I cannot reproduce it on Linux. REPRODUCIBLE EXAMPLE: % Rterm --vanilla # Tell R where Ghostscript is gsexe <- "C:/gs/gs8.54/bin/gswin32c.exe"; gsexe <- "C:/Program

Hi, I've installed several versions of R on a number of Window systems. I get the following error message (which I don't get on linux) > dev2bitmap(file="test.jpeg",type="jpeg") Error in system(paste(gsexe, "-help"), intern = TRUE, invisible = TRUE) : gswin32c.exe not found Any idea how to fix this? It seems common to all windows systems

On Wed, 11 Apr 2001 Setzer.Woodrow@epamail.epa.gov wrote: > When I execute the following code: > > bitmap("test.pdf",type="pdfwrite") > plot(1:10,1:10,main="ONE") > plot(1:10,1:10,main="TWO") > dev.off() > > the resulting file test.pdf contains four pages: graph ONE, graph TWO, > graph ONE, graph TWO. I can recreate the problem

Hi R users, dev2bitmap() is not working for me in R-1.1.0. It says: > dev2bitmap("aaa.png") Error in device(...) : Object "width" not found Anyone else has this problem? Aleksey -.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.- r-help mailing list -- Read http://www.ci.tuwien.ac.at/~hornik/R/R-FAQ.html Send "info",

Dear all, When saving a plot with the dev2bitmap command: name <- c("test.jpeg") dev2bitmap(name,type="jpeg",height=8,width=13,res=400) Everything seems to be ok... After importing this picture in CORELDRAW (for a poster A0) format the resolution and colors are not optimal. How can I save pictures (colors/resolution) optimally for import into CorelDraw for an

Hi, I am trying to put some graphics I have generated from R on a webpage using dev2bitmap to create a bitmap, .BMP, file. When I look at my notes from 2 or 3 months ago I was successfully able to put the ACTIVE device plot result into a bitmap file using a command such as: dev2bitmap("InsectSpray.BMP") Job done! Now when I try the same command, I get the following: >

Issue: I have a R script that is invoked periodically by another process. In the script, a graphics is generated and I want to get a the image for the graph as a jpeg. Here is a prototypical version of the script (try.R): plot(1) dev2bitmap("try.jpg", type = "jpeg") I am running R-1.0.0 on Solaris 7. The script is invoked as: R --vanilla < try.R A file named try.jpg is

Hi list, When exporting to PDF a graph with a legend, in the final PDF, the text is going beyond the legend box. > dev2bitmap("test.pdf", type="pdfwrite", h=6, w=6) The legend looks OK on the screen. I noticed that the size of the legend box depends on the size of the screen window, which is not the case for other graphical parts (text of the legend, title, axis

Hello, R users. I am trying to embed Computer modern fonts to an R plot and I get the following error. CM <- Type1Font("CM", + c(paste("cm-lgc/fonts/afm/public/cm-lgc/", + c("fcmr8a.afm", "fcmb8a.afm", "fcmri8a.afm", "fcmbi8a.afm"), sep=""), + "./cmsyase.afm")) > pdf("cm.pdf",

Michael Lapsley was suggesting on R-help direct copies to gif/png/jpeg. The following seems to do a sensible job for me of copying the current device to any bitmap format supported by gs. The manipulation is needed to work around assumptions made by postscript(), and I think better fixed in postscript() (but not a couple of days before a release). I want to make onefile=FALSE work on

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Hy all, I wish to get rid of starting X to get graphics, i tryed dev2bitmap and i've being working around without finding good parameters. By example : Dev2bitmap(file="Rplot001.png", type = "png256",width=600/72,height=486/72) par(mar=c(5,2,1,1),xaxs = "i", yaxs = "i",ps=13) I tryed with res=something inside dev2bitmap too and i'm

Hi, I'd been using R in the past and recently installed it on a new windoze 7 machine. There have been many issues with compatibility and 32/64 bit apps etc and I did find on google on isolated complaint that saveplot failed in scripts a long time ago. R seems to work fine except script-based plot saving as pdf has not worked. I have tried the following, none of which seem to function, xyz

Hi, Without trying to print 1000000 points (see <http:// finzi.psych.upenn.edu/R/Rhelp02a/archive/42105.html>), I often print maps for which I do not want to loose too much of coastline detail, and/or plots with 1000-5000 points (yes, some are on top of each other, but using transparency (i.e. rgb colors with alpha information) this actually comes through as useful information.

It would be nice for checking documentation to be able to generate the "see also" cross references (e.g. the list of functions where dev2bitmap is linked as a "see also" reference.) Perhaps this already exists? (BTW, it would be useful to have a "see also" reference to dev2bitmap in the help for postscript and for Devices.) Paul Gilbert

On Thu, Jul 7, 2011 at 1:35 PM, Anderson, Todd A <todd.a.anderson at intel.com>wrote: > ** ** > > On Thu, Jul 7, 2011 at 10:55 AM, Anderson, Todd A < > todd.a.anderson at intel.com> wrote:**** > > For the past few years, my group in Intel Labs has been working on a > project similar to LLVM and C--, and perhaps our experience in handling > roots and stack

I am having trouble saving graphs. Using the Aqua interface (which is not my preferred interface), I have no problems plotting a graph, adding additional lines, points, references, etc., and then saving it to a file using, for example, the dev2bitmap command. I have found that, running R with Xemacs+ESS under X11 (which I prefer over Aqua), this is not possible. I can either send the graph to a

On Thu, Jul 7, 2011 at 10:55 AM, Anderson, Todd A <todd.a.anderson at intel.com<mailto:todd.a.anderson at intel.com>> wrote: For the past few years, my group in Intel Labs has been working on a project similar to LLVM and C--, and perhaps our experience in handling roots and stack walking could be useful in deciding how LLVM should evolve in the GC area. Our project is called Pillar