similar to: Fw: It 's correct to do contrasts for a GLM?

Hi, I'm trying to redefine the contrasts for a linear model. With a 2 level factor, x, with levels A and B, a two level factor outputs A and B - A from an lm fit, say lm(y ~ x). I would like to set the contrasts so that the coefficients output are -0.5 (A + B) and B - A, but I can't get the sign correct for the first coefficient (Intercept). Here is a toy example, set.seed(12161952) y

Dear all, I would like to generate 25 numbers from 1 to 100 but I would like to have some numbers that could be more probable to come out. I was thinking of the function runif: runif(25, 1, 100) , but I don?t know how to give more weight to some numbers. Example: each number from 2 to 10 has the probability of 40% to come out but the probability of each number from 11 to 100 to come out is

Must packages in the Depends field of the DESCRIPTION file have NAMESPACES? I haven't seen this explicitly indicated anywhere. I am writing a small package and find that when I add the abind package to the list of the Depends field, I get an error in R CMD check of the build. * checking package name space information ... OK * checking package dependencies ... ERROR Packages required but not

I tried aggregate, apply etc, but can't get the right result. For example, m <- cbind(c(LETTERS[1:5]), c("aa", "bb", "cc", "aa", "cc")) [,1] [,2][1,] "A" "aa"[2,] "B" "bb"[3,] "C" "cc"[4,] "D" "aa"[5,] "E" "cc" how to obtain

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

I would like to do an R glm() with family = binomial(link="loglog") Right now, the cloglog link exists, which is nice when the data have a heavy tail to the left. I have the opposite case and the loglog link is what I need. Can someone suggest how to add the loglog link onto glm()? It would be lovely to have it there by default, and it certainly makes sense to have the two opposite

Hi all, I am trying to parse a vector for caliculating minimum in that vector the vector having values like 1 Kontrolle 2 Placebo 3 125mg/kg 4 250mg/kg 5 500mg/kg 6 1000mg/kg hear i tries for comverting it into numeric with using "as.numaric()" function but i got values like 5 6 2 3 4 1 it gives 1000mg/kg is the least one but i have

Hi folks, I've just discovered that the following code leads to boxplot (surprisingly to me). Can anybody explain to me why? Is this documented somewhere? I've never consider this option before. x <- rnorm(300) l <- c(rep("label1",100), rep("label2",50), rep("label3",150)) df <- data.frame(as.factor(l), x) plot(df) Thank you! Antje

Hi all, I've noticed that many computational neuroscience research groups use MATLAB. While it's possible that MATLAB may have some features unavailable in R, I suspect that this may instead simply be a case of costly tradition, where researchers were taught MATLAB as students and pay for it as researchers because it's all they know. I'd like to attempt to break the cycle by

I'm using scan in a script to record a series of responses of the user as a function of some graphs that I put up on the screen. A toy version would be, y <- rep(NA, 3) for (ix in seq( length(y) ) ) { y[ix] <- scan( n = 1 ) } However, if I include any code after this loop, for example, y <- rep(NA, 3) for (ix in seq( length(y) ) ) { y[ix] <- scan( n = 1 ) } y I get an error

Dear, I am trying to get a prediction of my GAM on a response type. So that I eventually get plots with the correct values on my ylab. I have been able to get some of my GAM's working with the example shown below: * model1<-gam(nsdall ~ s(jdaylitr2), data=datansd) newd1 <- data.frame(jdaylitr2=(244:304)) pred1 <- predict.gam(model1,newd1,type="response")* The problem I am

I would like to suppress the text 'Scatter Plot Matrix' that appears under the plot. Could someone please suggest how? _____________________________ Professor Michael Kubovy University of Virginia Department of Psychology USPS: P.O.Box 400400 Charlottesville, VA 22904-4400 Parcels: Room 102 Gilmer Hall McCormick Road Charlottesville, VA 22903 Office: B011

Hi all, Where f(x) is a logistic function, I have data that follow: g(x) = f(x)*.5 + .5 How would you suggest I modify the standard glm(..., family='binomial') function to fit this? Here's an example of a clearly ill-advised attempt to simply use the standard glm(..., family='binomial') approach: ######## # First generate some data ######## #define the scale and location of

Hi all, I have a rather naive question. I have the height of 100 individuals in a table and I want to assign the tallest 30% as Case=1 and the bottom 30% as Case=0. How do I do that? thanks. jiong The email message (and any attachments) is for the sole use of the intended recipient(s) and may contain confidential information. Any unauthorized review, use, disclosure or distribution is

I've just started using R and am still a neophyte, but I found the following curious result. I'm using the current version of R (2.5.1 (2007-06-27) ). Why are the results for the third quartile different in the output from the summary and fivenum commands? For the following data set 457 514 530 530 538 560 687 745 745 778 786 790 792

Hi, I was taken off guard by the following behavior in a lattice plot. I frequently want to add a predicted curve defined at more points than in the formula expression of xyplot. There have been numerous examples of how to do this on r-help, but I still often struggle to make this work. I just realized that specifying one of the axes on a log scale does not guarantee that the added data for a

Hi, I'm fitting a standard nonlinear model to the luminances measured from the red, green and blue guns of a TV display, using nls. The call is: dd.nls <- nls(Lum ~ Blev + beta[Gun] * GL^gamm, data = dd, start = st) where st was initally estimated using optim() st $Blev [1] -0.06551802 $beta [1] 1.509686e-05 4.555250e-05 7.322720e-06 $gamm [1] 2.511870 This works fine but I

Hello all I am working with the package multcomp but I have problems with the function simtest; the program say that can not find this function, nevertheless I doesn't have any problem with the function glht that it is in the same package. Someone knows what could be the problem? Thank you [[alternative HTML version deleted]]

Dear r-helpers, I wonder whether, given the "#rrggbb" representation of a colour, there is a simple way to select the complementary colour, also expressed as a "#rrggbb" string. Any suggestions would be appreciated. John -------------------------------- John Fox, Professor Department of Sociology McMaster University Hamilton, Ontario Canada L8S 4M4 905-525-9140x23604

Hi I'm using fracdiff package to estimate the parameters of a fractionally-differenced ARIMA (p,d,q) model, and it works fine, but I wanted to have also the filtered series and the series of residuals. I understand these are calculated in the subroutine fdfilt, in the program fdcore.f, but I can't manage to get them out. Any suggestion would be much appreciated Thanks Susana Barbosa