Displaying 20 results from an estimated 30000 matches similar to: "subsetting a data frame"
2008 Feb 02
2
transforming one column into 2 columns
Hello
I have a data frame and one of its columns is as follows:
Col
chr1:71310034
chr14:23354088
chr15:37759058
chr22:18262638
chrUn:31337214
chr10_random:4369261
chrUn:3545097
I would like to get rid of colon (:) and replace this column
with two new columns containing the terms on each side of the colon. The new columns
should look as follows:
Col_a Col_b
chr1
2008 Feb 23
2
counting sequence mismatches
Hello
I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this:
seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")
2008 Sep 14
5
difference of two data frames
Hello
I have 2 data frames DF1 and DF2 where DF2 is a subset of DF1:
DF1= data.frame(V1=1:6, V2= letters[1:6])
DF2= data.frame(V1=1:3, V2= letters[1:3])
How do I create a new data frame of the difference between DF1 and DF2
newDF=data.frame(V1=4:6, V2= letters[4:6])
In my real data, the rows are not in order as in the example I provided.
Thanks much
Joseph
[[alternative HTML version
2008 Feb 06
4
inserting text lines in a dat frame
Hi Jim
I am trying to prepare a bed file to load as accustom track on the UCSC genome browser.
I have a data frame that looks like the one below.
> x
V1 V2 V3
1 chr1 11255 55
2 chr1 11320 29
3 chr1 11400 45
4 chr2 21680 35
5 chr2 21750 84
6 chr2 21820 29
7 chr2 31890 46
8 chr3 32100 29
9 chr3 52380 29
10 chr3 66450 46
I would like to insert the following 4 lines at the beginning:
2009 May 21
2
help with gsub and date pattern
Dear List,
I am having a problem using gsub to remove dates from a date/time string.
For example:
x<-c("5/31/2009 12:34:00","6/1/2009 1:14:00")
I would like to remove the date and have just the time.
I have tried:
gsub("[0-9+]/[0-9+]/[0-9+]","",x)
and various versions. I think my problem is that the / is a special character and is telling it
2008 Feb 12
3
merging more than 2 data frames
Hi
merge() takes only 2 data frames. What can you do to it to make take more than two data frames? or is there another function that does that?
Thanks
joseph
____________________________________________________________________________________
Looking for last minute shopping deals?
[[alternative HTML version deleted]]
2008 Feb 10
11
data frame question
Hello
I have 2 data frames df1 and df2. I would like to create a
new data frame new_df which will contain only the common rows based on the first 2
columns (chrN and start). The column score in the new data frame
should
be replaced with a column containing the average score (average_score) from df1
and df2.
df1= data.frame(chrN= c(“chr1”, “chr1”, “chr1”, “chr1”, “chr2”,
“chr2”, “chr2”),
2013 Apr 18
5
Subsetting a large number into smaller numbers and find the largest product
Hello,
I have a big number lets say of around hundred digits. I want to subset
that big number into consecutive number of 5 digits and find the product of
those 5 digits. For example my first 5 digit number would be 73167. I need
to check the product of the individual numbers in 73167 and so on.
The sample number is as follows:
2008 Jul 27
1
64-bit R on Mac OS X 10.5.4
Hi Matt
Your method is the easiest way for me to install the 64-bit R. I followed the directions on your web site and then did the following:
R --arch=x86_64
source("http://bioconductor.org/biocLite.R")
biocLite(type = "source",lib = "/Library/Frameworks/R.framework/Versions/2.8/Resources/RLib64")
I got many errors and warnings which I copied to the attached file.
2008 May 25
3
naming components of a list
Hi
I have a character vector with thousands of names which looks like this:
> V=c("Fred", "Mary", "SAM")
> V
[1] "Fred" "Mary" "SAM"
> class(V)
[1] "character"
I would like to change it to a list:
> L=as.list(V)
> L
[[1]]
[1] "Fred"
[[2]]
[1] "Mary"
[[3]]
[1] "SAM"
but I need to
2005 Jul 22
3
Question regarding subsetting
I run R 2.1.1 in a Linux environment (RedHat 9) although my question
is not platform-specific.
Consider the following:
> A <- c("Prefix-aaa", "Prefix-bbb", "Prefix-ccc")
> B <- strsplit(A, "-")
> B
[[1]]
[1] "Prefix" "aaa"
[[2]]
[1] "Prefix" "bbb"
[[3]]
[1] "Prefix" "ccc"
How
2002 Oct 28
2
subsetting character vector into groups of numerics
I'm sure there's a simple way to do this, but I can only think of
complicated ones.
I have a number of character vectors that look something like this:
"12 78 23 9 76 43 2 15 41 81 92 5(92 12) (81 78 5 76 9 41) (23 2 15 43)"
I wish to get it into a list of numerical vectors like this:
$Group
[1] 12 78 23 9 76 43 2 15 41 81 92 5
$Subgroup1
[1] 92 12
$Subgroup2
[1] 81 78 5
2008 Feb 18
3
remove column names from a data frame
I want to remove the column names from a data frame. I do
it the long way, can any body show me a better way ?
df= data.frame(chrN= c(“chr1”, “chr2”, “chr3”), start= c(1,
2, 3), end= c(4, 5, 6), score= c(7, 8, 9))
df
#I write a txt file without row or column names
write.table(df,"df1.txt",sep='\t',quote=FALSE,row.names=F,col.names=F)
#then I read it with the header = F
2010 Mar 07
2
data.frame question
hello
can you show me how to create a data.frame from two factors x and y. column 1 should be equal to x and column 2 is 1 if it is common to y and 0 if it is not.
x=factor(c("A","B","C","D","E","F","G"))
y=factor(c("B","C","G"))
the output should look like this:
A 0
B 1
C 1
D 0
E
2008 Feb 08
1
convertin a data frame column from character to numeric
I have a data.frame with all character columns, I would like to convert the last two columns into numeric.> x[1:5, ] chrN start end 1 chr1 71310034 71310064 2 chr14 23354088 23354118 3 chr14 71310034 71310064 4 chr15 37759058 37759088
5 chr22 18262638 18262668 > apply(x, 2, FUN = mode) chrN start end
2007 Feb 19
2
Another subsetting enigma
Hello again,
I'm trying to do the following:
subset(dataframe,list %in% strsplit(dataframe[[Field]],","))
But This returns always the complete dataframe, since the
strsplit(dataframe[[Field]],",") is evaluated as one big list for the whole
data frame rather than one list per row. How can I have this evaluated on a
per row basis?
After 1.5 h hitting head against wall -
2008 Feb 04
1
counting identical data in a column
Hi Peter
I have the following data frame with chromosome name, start and end positions:
chrN start end
1 chr1 11122333 11122633
2 chr1 11122333 11122633
3 chr3 11122333 11122633
8 chr3 111273334 111273634
7 chr2 12122334 12122634
4 chr1 21122377 21122677
5 chr2 33122355 33122655
6 chr2 33122355 33122655
I would like to count the positions that have the same start and
2008 Jun 12
2
numbers as part of long character
Hi,
I'm looking for some way to pick up the numbers which are contained and buried in a long character.
For example,
outtree.new="(((B:1204.25,E:1204.25):7581.11,F:8785.36):8353.85,C:17139.21);"
num.char =
2009 Jul 24
3
str(data.frame) after subsetting reflects original structure, not subsetted structure?
I find that after subsetting (you may prefer "conditional selection") a data
frame and assigning it to a new object, the str(new object) reflects the
original data frame, not the new one:
A <- rnorm(20)
B <- factor(rep(c("t", "g"), 10))
C <- factor(rep(c("h", "l"), 10))
D <- data.frame(A, B, C)
str(D) # reports correctly
E <-
2012 Dec 27
4
Finding (swapped) repetitions of numbers pairs across two columns
Hi,
I've had this problem for a while and tackled it is a quite dirty way
so I'm wondering is a better solution exists:
If we have two vectors:
v1 = c(0,1,2,3,4)
v2 = c(5,3,2,1,0)
How to remove one instance of the "3,1" / "1,3" double?
At the moment I'm using the following solution, which is quite horrible:
v1 = c(0,1,2,3,4)
v2 = c(5,3,2,1,0)
ft <-