similar to: Howto reduce number of ticks in X, Y axis while still containing all the data

Dear all, For example I want to process set of files. Typically Perl's idiom would be: __BEGIN__ @files = glob("/mydir/*.txt"); foreach my $file (@files) { # process the file } __END__ What's the R's way to do that? - Gundala Viswanath Jakarta - Indonesia

Hi all, I have the following named list: > print(y) $`200052_s_at` [1] -1066.975 -1063.893 -1062.815 -1062.121 -1059.004 $`200071_at` [1] -959.823 -953.980 -953.886 -948.781 -974.890 $`200084_at` [1] -1135.804 -1132.863 -1128.197 -1128.633 -1125.890 What I want to do is to iterate this name list and process its members. To do that I attempt the following code (but failed): __BEGIN__ ny

Hi, How can I partitioned an example vector like this > print(myvector) [1] 30.9 60.1 70.0 73.0 75.0 83.9 93.1 97.6 98.8 113.9 into the following pairwise partition: PAIR1 part1 = 30.9 part2 = 60.1 70.0 73.0 75.0 83.9 93.1 97.6 98.8 113.9 PAIR2 part1 = 30.9 60.1 part2 = 70.0 73.0 75.0 83.9 93.1 97.6 98.8 113.9 .... PAIR9 part1 = 30.9

Hi, With the following codes, I attempt to convert the data.frame into a matrix. However I notice that data.matrix function doesn't seem to work. __ BEGIN__ dat <- read.table("mydata", comment.char = "!" , na.strings = "null"); # Select n-genes by random sample # n = 1 nosamp <- 1 geneid <- sequence(nrow(dat)) geneid.samp <- sample(geneid,nosamp)

Dear all, I found that printing with 'cat' is very slow. For example in my machine this snippet __BEGIN__ # I need to resolve to use this type of loop. # because using write(), I need to create a matrix which # consumes so much memory. Note that "foo, bar, qux" object # is already very large (>2Gb) for ( s in 1:length(x) ) {

Hi, Currently I have a density plot generated with this snippet. Is there a way I can add a line curve on top of it? I mean in one figure __BEGIN__ myhist <- hist(x col="blue", main = "Density Plot", xlab = "Exp Level", ) __END__ - Gundala Viswanath Jakarta - Indonesia

Dear all, Does R has any function/package that can pack and unpack string into bit size? The reason I want to do this in R is that R has much more native statistical function than Perl. Yet the data I need to process is so large that it required me to compress it into smaller unit -> process it -> finally recover them back again into string with new information. In Perl the

Hi, Suppose I have the following data frame. __BEGIN__ > library(MASS) > data(crabs) > crab.pca <- prcomp(crabs[,4:8],retx=TRUE) > crab.pca$rotation PC1 PC2 PC3 PC4 PC5 FL 0.2889810 0.3232500 -0.5071698 0.7342907 0.1248816 RW 0.1972824 0.8647159 0.4141356 -0.1483092 -0.1408623 CL 0.5993986 -0.1982263 -0.1753299 -0.1435941 -0.7416656 CW

Hi all, I have the following data in which I want to parse and store them in a list __DATA__ > print(comp.ll) [1] "\tGene 11340 211952_at RANBP5 k= 1 LL= -970.692 " [2] "\tGene 11340 211952_at RANBP5 k= 2 LL= -965.35 " [3] "\tGene 11340 211952_at RANBP5 k= 3 LL= -963.669 " [4] "\tGene 12682 213301_x_at TRIM24 k= 1 LL= -948.527 "

Hi, I have the following dataset (simplified for example). __DATA__ 300.35 200.25 104.30 22.00 31.12 89.99 444.50 22.10 43.00 22.10 200.55 66.77 Now from that I wish to do the following: 1. Compute variance of each row 2. Pick top-2 row with highest variance 3. Store those selected rows for further processing To achieve this, I tried to: a) read the table and compute variance for each row,

Hi Dieter, Sorry my mistake. I wanted to convert them into Decimal (not Hexadecimal). Given this string, the desired answer follows: > ascii_str <- "ORQ>IK" 79 82 81 62 73 75 > ascii_str2 <- "FDC" 70 68 67 - Gundala Viswanath Jakarta - Indonesia On Mon, Dec 22, 2008 at 5:49 PM, Dieter Menne <dieter.menne at menne-biomed.de> wrote: > Gundala

Hi all, I've tried to plot a vector which has two peaks in the density. This link shows the figure. http://docs.google.com/View?docid=dcvdrfrh_1dk9r2rc7 The red line is normal curve and green line is gamma curve. Notice that red line can correctly fit the histogram that has two peaks (i.e. red curve also has two peaks). But the gamma curve there only has one curve. Is there a way I can

Dear all, I have the following code that try to plot simple sinus curve into 2x2 grid in 1 page. But this code of mine create 4 plots in 1 page each. What's wrong with my approach? __BEGIN__ library(lattice) library(grid) test.plot <- function(x,y) { pushViewport(viewport(layout.pos.col=x, layout.pos.row=y)) pushViewport(viewport(width=0.6, height=0.6)); plot(sin,-pi,2*pi, main=

Hi all, Suppose I have 2 matrices A and B. And I want to measure how good each of this matrix is. So I intend to compare A and B with another "gold standard" matrix X. Meaning the more similar a matrix to X the better it is. What is the common way in R to measure matrix similarity (ie. A vs X, and B vs X) ? - Gundala Viswanath Jakarta - Indonesia

Hi, I have the following vector which is created from 3 distinct distribution (three components) of gamma: x=c(rgamma(30,shape=.2,scale=14),rgamma(30,shape=12,scale=10),rgamma(30,shape=5,scale=6)) I want to plot the density curve of X, in a way that it shows a distinct 3 curves that represent each component. How can I do that? I tried this but doesn't work: lines(density(x)) Please

Hi, I have the following (M x N) matrix, where M = 10 and N =2 What I intend to do is to group index of (M) based on this condition of "x_mn" , namely For each M, If x_m1 > x_m2, assign index of M to Group1 otherwise assign index of M into Group 2 > x [,1] [,2] [1,] 4.482909e-01 0.55170907 [2,] 9.479594e-01 0.05204063 [3,] 8.923553e-01 0.10764474

Hi, How can I extract the label only from a given data frame. Fore example from this data frame. > print(dataf) V1 V2 V3 V4 V5 V6 V7 V8 V9 11145 14.3 17.1 31.2 41.7 45.8 49.8 68.6 70.6 72.9 3545 10.2 15.6 20.9 23.2 31.4 31.7 36.2 48.4 51.9 8951 15.2 17.5 20.0 21.4 32.4

Hi all, After running this code (attaches is the input file): dat <- read.table("gene_prob.txt", sep = "\t") n <- length(dat$V1) print(n) print(dat$V1) I get this print out. ...... [8541] LOC552889 GPR15 SLC2A11 GRIP2 SGEF [8546] PIK3IP1 RPS27 AQP7 8548 Levels: 3.8-1 A2M A4GALT A4GNT AAAS AAK1 AAMP AANAT AARSD1 AASS ...

Dear all, I have the following matrix. > dat A A A A A A A A A A [1,] 0 0 0 0 0 0 0 0 0 0 [2,] 0 0 0 0 0 0 0 0 0 1 [3,] 0 0 0 0 0 0 0 0 0 2 How can I change it into: [,1] [,2] [,3] [,4] [,5] [,6] [,7] [,8] [,9] [,10] [1,] 0 0 0 0 0 0 0 0 0 0 [2,] 0 0 0 0 0 0 0 0 0 1

Dear all, What's the R way to compress the string into smaller 2~3 char/digit length. In particular I want to compress string of length >=30 characters, e.g. ACGATACGGCGACCACCGAGATCTACACTCTTCC The reason I want to do that is because, there are billions of such string I want to print out. And I need to save disk space. - Gundala Viswanath Jakarta - Indonesia