similar to: Any simple way to subset a vector of strings that do contain a particular substring ?

Dear friends, How do I stop partial matching of list names? e.g., x <- list(AAAA="aaaaa", BBBBB="bbbbb") is.null(x$A) #returns FALSE even though there is no element A. if(is.null(x$A)) {result <- x$BBBB} else {result <- x$A} result #is aaaa even though there is no x$A element x <- list(CCCC="aaaaa", BBBBB="bbbbb") if(is.null(x$A))

Dear R helpers, Suppose I have following data.frame. df <- data.frame(category = c("treat_A", "treat_A", "treat_A", "treat_A", "treat_A", "treat_A", "treat_A", "treat_A", "treat_B", "treat_B", "treat_B", "treat_B", "treat_B", "treat_B",

I have two factors l1, l2, and I'd like to merge them. (Remark: The factors can not be converted to charaters) Function c() does not give me the result I want: > l1 = factor(c('aaaa', 'bbbb')) > l2 = factor(c('ccc', 'dd')) > lMerge = factor(c(l1, l2)) > lMerge [1] 1 2 1 2 Levels: 1 2 > I'd like to merge l1 and l2 and to get lMerge

OK. "passdb/userdb" Setting part $ dovecot -n (Excerpt from change) ---------------------------------------------------------------------------- --------------------- passdb { args = scheme=CRYPT username_format=%u /etc/dovecot/users.auth driver = passwd-file } userdb { args = username_format=%u /etc/dovecot/users.auth driver = passwd-file } protocol lmtp { info_log_path =

I can't get IPv6 routing to configure correctly despite everything I've read saying it should This is my network config on a fully-updated CentOS 5.8 system: # cat /etc/sysconfig/network NETWORKING=yes NETWORKING_IPV6=yes HOSTNAME=my.hostname.com GATEWAY=aaa.bbb.ccc.ddd IPV6_DEFAULTGW=2a02:aaaa.bbbb::1 IPV6_DEFAULTDEV=eth0 # cat /etc/sysconfig/network-scripts/ifcfg-eth0

I suspect that this is simple, but thanks in advance for any advice... I have a dataframe, t2: V1 V2 aaa 3 aaaa 4 aaaaaa 6 a 1 aa 2 V2 is the length of the string in V1 using nchar(as.character(t1$V1)) I'd like to create a third column, that contains a string of the length of V2, but containing an alternate text, e.g. V1 V2 V3

Hi R users, I am new to R and am trying to merge data frames in the following way. Suppose I have n data frames each with two fields. Field 1 is common among data frames but may have different entries. Field 2 is different. Data frame 1: Src Target1 1 aaa 1 bbb 1 ccc 2 aaa 3 ddd Data frame 2: Src Target2 2 aaaa 3 dddd 4 bbbb 4

I've been trying out IPv6 networking with tinc and noticed that it will not route smaller segments than /48 If I try to run ip -6 route add aaaa:bbbb:cccc:dddd::/64 dev tun0 I get network unreachable However if I run ip -6 route add aaaa:bbbb:cccc::/48 dev tun0 it works fine Is this is a limitation in tinc or the kernel network stack itself? -------------- next part -------------- An HTML

I've the following error : Doing a node status request to the domain master browser at IP aaaa.bbbb.cccc.dddd failed First time I configure my smb.conf file on a server with the adress aaaa.bbbb.cccc.dddd For some raison I have to change this address for another. When I restart samba I the message : nmbd/nmbd_browsesync.c:get_domain_master_name_node_status_fail(486)

Thanks for the previous tips and suggestions. Here's a more concise example: Input file: <aaaa> <bbbb> <cccc> <dddd> I want everything on one line, i.e., remove all newlines. Like so: <aaaa><bbbb><cccc><dddd> Simple perl code: #!/usr/bin/env perl # Remove newlines from a file in two ways: # (1) Just "chomp" them; # (2) Replace

When VFS full_audit is activated the server doesn't allow users to write changes in any file. The log vfs:10 shows: Jan 12 22:22:00 loginserver smbd_audit: aaaa.bbbb|192.168.23.10|get_real_filename|fail (Operation not supported)|/Novo Documento de Texto.txt->(null) Jan 12 22:22:00 loginserver smbd_audit: aaaa.bbbb|192.168.23.10|fchmod_acl|fail (No data available)|Novo Documento de

Hi I'm sorry. I mailed the same question again. because, it cannot be yet solved. any ideas with asterisk? [Aug 20 14:40:12] WARNING[29315]: chan_sip.c:11806 check_auth: username mismatch, have <aaaa>, digest has aaaa at 192.168.0.1[Aug 20 14:40:12] NOTICE[29315]: chan_sip.c:20479 handle_request_register: Registration from 'aaaa <sip:aaaa at 192.168.0.1>' failed for

For example, c("dog.is.an.animal", "cat.is.an.animal", "rat.is.an.animal"). How can I identify the common prefix is ".is.an.animal" and delete it to give c("dog", "cat", "rat") ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]

I have 2 nodes nodeA and nodeB I'm using tinc 1.1pre11 -- nodeA(fd80:2015:2105:abcd::1) : $ ip -6 route fd80:2015:2105:abcd::1 dev tun0 proto kernel metric 256 fd80:2015:2105:adcd::/64 dev tun0 metric 1024 fe80::/64 dev eth0 proto kernel metric 256 $ ping6 fd80:2015:2105:abcd::1 PING fd80:2015:2105:abcd::1(fd80:2015:2105:abcd::1) 56 data bytes 64 bytes from fd80:2015:2105:abcd::1:

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

I am generating a report containing several R scripts in the appendix. Is there any way to "beautify" the R source codes in microsoft word, similar to what we see in tinn-R ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]

Hi Thanks Gabor for your suggestion. I am posting the code that worked for me. dataframe1 = data.frame(cbind(Src = c(1,1,1,2,3), Target1 = c('aaa','bbb','ccc','aaa','ddd'))); #must be data frame dataframe2 = data.frame(cbind(Src = c(2,3,4,4,4), Target2 = c('aaaa','dddd','bbbb','eeee','ffff'))); dataframe3 =

I have a folder full of pngs and jpgs, and would like to consolidate them into a pdf with appropriate title and labels. Can this be done via R ? _________________________________________________________________ Easily publish your photos to your Spaces with Photo Gallery. [[alternative HTML version deleted]]

Hi, I have developed some scripts that basically ask for input tab-limited format files, do some processing, and output several pictures or csv. Now I need to have some gui to wrap on top of the scripts, so that end-users can select their input files, adjust some parameters for processing, and select output folder or filenames. Please advice me if there is any tools or project suitable for

Dear all, I have a lot of problems on R-programming. for example my csv. file is .. Date wrfRH wrfsolar wrfwindspeed wrfrain wrftd wrfta 21/10/2010 92.97 22.11 53.27 0 1546.337861 61.00852664 22/10/2010 87.35 21.99 40.89 0 1300.408288 62.85352227 23/10/2010 88.38 21.71 28.04 0.01 1381.768284 54.80594493 24/10/2010 92.32 15.45 22.38 0.51 1113.90981 39.46573663 25/10/2010 93.42