similar to: operations on all pairs of columns from two matrices

My two matrices are roughly the sizes of m1 and m2. I tried using two apply and cor.test to compute the correlation p.values. More than an hour, and the codes are still running. Please help to make it more efficient. m1 <- matrix(rnorm(100000), ncol=100) m2 <- matrix(rnorm(10000000), ncol=100) cor.pvalues <- apply(m1, 1, function(x) { apply(m2, 1, function(y) { cor.test(x,y)$p.value

Hi, For example, given two 2x2 matrices m1 and m2. I would like to add/subtract element by element > m1 [,1] [,2] [1,] NA NA [2,] 1 2 > m2 [,1] [,2] [1,] 1 NA [2,] NA 2 > m1 + m2 [,1] [,2] [1,] NA NA [2,] NA 4 How can I ignore the NA, and get this ? Hope the solution can be extended to subtract and modulo also. [,1] [,2]

For example, c("dog.is.an.animal", "cat.is.an.animal", "rat.is.an.animal"). How can I identify the common prefix is ".is.an.animal" and delete it to give c("dog", "cat", "rat") ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]

I've been scratching my head over this one for too long. I'm hoping someone out there can solve this riddle. I have two vectors of characters, v1 and v2, both of length L, and two matrices of logicals, m1 and m2, both of dimension N*L. The first matrix of logicals corresponds to the first vector of characters, and the second to the second. The matrices are telling me which of the

Dear Members, I have two estimated transition matrices and I want to compare them. In fact I want to check the hypothesis if they come from the same process. I tried to look for some test but all I found was independence test of contingency tables. The following code shows that the usual chi-squared test statistic does not follow chisq distribution. MCRepl <- 5000 khi12 <- rep(0,MCRepl)

For example, strings <- c("aaaa", "bbbb","ccba"). How to get "aaaa", "bbbb" that do not contain "ba" ? _________________________________________________________________ [[alternative HTML version deleted]]

Dear R-helpers, I have a huge data-set so need to avoid for loops as much as possible. Can someone think how I can compute the result in the following example (that uses a for-loop) using some version of apply instead (or any other similarly super-efficient function)? example: #Suppose a matrix: m1=cbind(1:5,1:5,1:5) #The aim is to create a new matrix with every column containing the

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

How can I compute the pearson correlation p-values for all combinations of columns of 2 matrices ? > m <- matrix(rnorm(20), nrow=4, dimnames=list(LETTERS[1:4], letters[1:5])) > m1 <- matrix(rnorm(20), nrow=4, dimnames=list(LETTERS[1:4], letters[1:5])) > cor(m,m1) a b c d e a -0.67533294 -0.2516151 -0.3780815 0.55816011

Dear R users, I want to check matrices when i change the order of the rows or/and the order of the columns or/and the combination of them i will give an example what i want  1  -1  1  1      1  1   1  1 -1  -1 -1 -1    -1 -1  -1  -1   1  1    1  1     1 -1    1   1 these 2 matrices are identical because i change the first row and make it third   1  -1  1  1      -1  1   1  1 -1  -1 -1

I am generating a report containing several R scripts in the appendix. Is there any way to "beautify" the R source codes in microsoft word, similar to what we see in tinn-R ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]

Hi, I''m trying to get a handle on hfsc. Here is my configuration: root@jmnrouter:/jmn# tc class show dev vlan1 class hfsc 1: root class hfsc 1:1 parent 1: ls m1 0bit d 0us m2 225000bit ul m1 0bit d 0us m2 225000bit class hfsc 1:10 parent 1:1 rt m1 191000bit d 25.0ms m2 135000bit ls m1 0bit d 0us m2 135000bit ul m1 0bit d 0us m2 225000bit class hfsc 1:20 parent 1:1 rt m1 22008bit d

Dear All, I have two matrices A (40 x 732) and B (40 x 1230) and would like to calculate correlation between them.  I can use: cor(A,B, method="pearson") to calculate correlation between all possible pairs. But the issue is that there is one-many specific mappings between A and B and I just need to calculate correlations for those pairs (not all). Some variables in A (proteins, say p1)

Dear list, I have the following problem. I have a data frame like this CLUSTER YEAR variable Delta R_pivot M1 2005 EC01 NA NA M1 2006 EC01 2 NA M1 2007 EC01 4 5 M2 2005

Hi everyone, I'm having trouble applying the Cor() function to two matrices, both of which contain NAs. I am doing the following: a<-cor(m1, m2, use="complete.obs") ... and I get the following error message: Error in cor(m1, m2, use = "complete.obs") : no complete element pairs Does anyone know how I can apply a correlation, ignoring any NAs? Thanks, rcoder --

Hello, I have another stupid question. I hope you can give me a hint how to solve this: I have a list and one element is again a list containing matrices, all of the same dimensions. Now, I'd like to set the dimnames for all matrices: example code: m1 <- matrix(1:25, nrow=5) m2 <- matrix(26:50, nrow=5) # ... there can be much more than two matrices l <- list() l[[1]] <-

I have a folder full of pngs and jpgs, and would like to consolidate them into a pdf with appropriate title and labels. Can this be done via R ? _________________________________________________________________ Easily publish your photos to your Spaces with Photo Gallery. [[alternative HTML version deleted]]

Dear list, I'll try to be more clear in explaining my problem. I have a data frame like this called X: CLUSTER YEAR variable value1 value2 M1 2005 EC01 NA NA M1 2006 EC01 2 5 M1 2007

Hi, everyone I am trying to estimate 3 parameters for my survival function. It's very complicated. The negative loglikelihood function is: l<- function(m1,m2,b) -sum( d*( log(m1) + log(m2) + log(1- exp(-(b + m2)*t)) ) + (m1/b - d)*log(m2 + b*exp(-(b + m2)*t) ) + m1*t - m1/b*log(b+m2) ) here d and t are given, "sum" means sum over these two vairables. the parameters

Hi, I have developed some scripts that basically ask for input tab-limited format files, do some processing, and output several pictures or csv. Now I need to have some gui to wrap on top of the scripts, so that end-users can select their input files, adjust some parameters for processing, and select output folder or filenames. Please advice me if there is any tools or project suitable for