similar to: Selecting timestamps

Displaying 20 results from an estimated 700 matches similar to: "Selecting timestamps"

2007 Dec 05
2
exim/kmail vs. dovecot
I am using exim via dovecot_deliver to store messages in Maildir in my $HOME. I am using kmail to retrieve stuff. Unfortunately, something in my data crashes dovecot. I was using 1.0.rc14 from opensuse, but downloaded and installed 1.0.8 from the site. Here is the crash: Dec 5 18:05:09 h743107 dovecot: IMAP(kris): file mail-index-transaction.c: line 629 (mail_index_update_flags_range):
2008 Feb 23
2
counting sequence mismatches
Hello I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")
2012 Feb 20
1
counting characters starting point
I have three character strings represented below as seq1, seq2, and seq3. Each string has a reference character different from the other. Thus, for seq1, the reference character is U, seq2, S (3rd S from left where A is leftmost character) and for seq3 Y. seq1 = PQRTUWXYseq2 = AQSDSSDHRSseq3 = EEZYJKFFBHO I wish to generate a 3 by 26 matrix where 3 represent seq1, seq2, seq3 and 26 the letters of
2012 Oct 17
3
subtotals based on price bands?
I would like to create a subtotal table with custom bands. seq1 = seq(0, 100, by = 5) seq2 = seq(100, 1000, by = 100) Bands = c(seq1, seq2) #Prices Prices = sample(1:1000, 200, replace=F) #corresponding size for the given price above. size = sample(1:1000, 200, replace=F) How would I find the subtotal of the size based on a given price falls within a band? -- View this message in
2008 May 28
2
Unexpected behaviour in reading genomic coordinate files of R-2.7.0
Great R people, I have noticed a strange behaviour in read.delim() and friends in the R 2.7.0 version. I will describe you the problem and also the solution I already found, just to be sure it is an expected behaviour and also to tell people, who may experience the same difficulty, a way to overcome it. And also to see if it is a proper behaviour or maybe a correction is needed. Here is the
2007 Jan 26
2
Why do return or visible don´t return my objekt?
Dear RRRRRrrrrrrrrlist! I?ve got two lists which contain sets of DNA-sequences. They look something like this: List of 33 $ Cunonia_atrorubens : chr [1:247] "t" "t" "n" "t" ... $ Cunonia_balansae : chr [1:254] "t" "c" "c" "c" ... $ Cunonia_capensis : chr
2019 Jan 15
2
Cannot access other computers on LAN
Hello Julien, Am Tue, 15 Jan 2019 09:30:23 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > In that case I see: > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq1, length 64 > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq2, length 64 > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq3, length 64 > > Packet goes
2006 Jun 22
3
recent dovecot: assertion failed.
Hi, today I have built dovecot from cvs sources, and upgraded server from beta-7 to this newer version. Then i got problems with opening INBOX using thunderbird 1.5.0.2. The client says "Opening folder...", then, after about half a minute, blinking "connecting to the server" and returning to "Opening folder..." /var/log/maillog gets the messages: --- Jun 22
2007 Dec 09
1
List comprehensions for R
Below is code that introduces a list comprehension syntax into R, allowing expressions like: > .[ sin(x) ~ x <- (0:11)/11 ] [1] 0.00000000 0.09078392 0.18081808 0.26935891 0.35567516 0.43905397 [7] 0.51880673 0.59427479 0.66483486 0.72990422 0.78894546 0.84147098 > .[ .[x*y ~ x <- 0:3] ~ y <- 0:4] [,1] [,2] [,3] [,4] [,5] [1,] 0 0 0 0 0 [2,] 0 1 2
2007 Sep 02
2
imap process consuming 100% CPU (Dovecot 1.0.3)
Hi, I have yet another problem with Dovecot: sometimes (rarely, maybe once every few days) one of the imap processes will 'hang', consuming all available CPU time. It does not seem to 'finish' in any reasonable amount of time (in one instance I waited a few days). This process will not even exit gracefully, it needs to be killed with 'kill -9 <PID>'. It has
2008 Mar 28
1
How to schedule R scripts?
useRs, Is there a way to schedule R scripts? I would like to run certain scripts three times a day. I'm running R on Windows XP. > sessionInfo() R version 2.6.0 (2007-10-03) i386-pc-mingw32 locale: LC_COLLATE=Finnish_Finland.1252;LC_CTYPE=Finnish_Finland.1252;LC_MONETARY=Finnish_Finland.1252;LC_NUMERIC=C;LC_TIME=Finnish_Finland.1252 attached base packages: [1] splines grid stats
2005 Jul 18
2
Assertion failure in mail-index-transaction.c
I just noticed one instance of this in the current CVS version: dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): mbox sync: Expunged message reappeared in mailbox /mailhome/new/o/h/mailuser/mbox (UID 2834 < 2872) dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): file mail-index-transaction.c: line 129 (mail_index_buffer_convert_to_uids): assertion failed: (*seq != 0) dovecot: Jul
2008 Jun 30
2
Plotting question: Problem with strwidth in 2.7.1
R users, I have a problem with function strwidth in 2.7.1. I'm trying to set the plot margins in a way that horizontal column labels will fit to the graph. tmp.t is a list of data.frame objects. This code works well in 2.6.0. ...snip.. library(gplots) for (i in names(tmp.t)) { bmp(filename=paste(i, "_", Sys.Date(), ".bmp", sep=""), width=1038,
2019 Jan 15
2
Cannot access other computers on LAN
Hello Julien, Am Mon, 14 Jan 2019 22:15:47 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > ** Test 1 ** > On VPN_office I use 'tcpdump -npi any icmp and host 192.168.1.3' > When pinging 192.168.1.1 from client 1, with no success, I see no packet > passing. Sorry - the tcpdump command should end with "192.168.1.1" instead of
2007 Dec 19
3
array addition
Hi suppose I have two arrays x1,x2 of dimensions a1,b1,c1 and a2,b2,c2 respectively. I want x = x1 "+" x2 with dimensions c(max(a1,a2), max(b1,b2),max (c1,c2)) with x[a,b,c] = x1[a1,b1,c1] + x2[a2,b2,c2] if a <=min(a1,a2) , b<=min (b1,b2), c<=min(c1,c2) and the other bits either x1 or x2 or zero according to whether the coordinates are "in range" for
2019 Jan 15
0
Cannot access other computers on LAN
Le mar. 15 janv. 2019 à 03:13, Lars Kruse <lists at sumpfralle.de> a écrit : > Hello Julien, > > > Am Mon, 14 Jan 2019 22:15:47 +0100 > schrieb Julien dupont <marcelvierzon at gmail.com>: > > > > ** Test 1 ** > > On VPN_office I use 'tcpdump -npi any icmp and host 192.168.1.3' > > When pinging 192.168.1.1 from client 1, with no success, I
2009 Oct 20
2
Problems importing Unix SAS .ssd04 file to R (Win)
Hello, I'm trying to import a SAS file made using SAS on Unix. Currently I'm using SAS on Windows and I'm trying to import that .ssd04 file to R. The file name of the file is testfile.ssd04 and it is located in 'M:\sasuser'. I'm using Windows XP and R 2.91. Basically what I'm doing is ############ r code ############## > library(foreign) > sashome <-
2018 Dec 08
2
Possible encoding bug in sub()
I noticed that sub() gives unexpected results for the following test case. In the test case, the (initial) input is ASCII but the replacements are UTF-8. The first sub() produces an UTF-8 result with an "unknown" Encoding. This makes the result garbled in Windows (no UTF-8 locale there). The second sub() produces a correct result, although for some reason it is converted to the native
2010 Jul 23
1
model.tables call fails with "Error in inherits(object, "formula")"
Hello, I noticed that model.tables fails when applied to an aov() fit if called inside a function. The problem seems to occur when as.formula is used inside a function on a string containing "<formula> + Error( x / y )" The reason I tried to use as.formula is to generate dynamic calls to aov(). Here is a minimal example illustrating the problem: ## Example test <-
2010 Feb 08
4
Problem with R on USB-drive
Hi, I installed R on USB-drive, but when I run Rgui.exe from bin folder, I get this error: ----------------------- R version 2.10.1 (2009-12-14) Copyright (C) 2009 The R Foundation for Statistical Computing ISBN 3-900051-07-0 R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for