Displaying 20 results from an estimated 900 matches similar to: "array addition"
2012 Dec 10
3
equivalent of group command of the egen function in Stata
Dear R listers,
I am trying to create a new variable that uniquely identifies groups of
observations in a dataset. So far I couldn't figure out how to do this in
R. In Stata I would simply type:
egen newvar = group(dim1, dim2, dim3)
Please, find below a quick example to show what I am dealing with:
I have a dataset with 4 variables:
var <- runif(50) ## a variable that I want to group
2007 Dec 09
1
List comprehensions for R
Below is code that introduces a list comprehension syntax into R,
allowing expressions like:
> .[ sin(x) ~ x <- (0:11)/11 ]
[1] 0.00000000 0.09078392 0.18081808 0.26935891 0.35567516 0.43905397
[7] 0.51880673 0.59427479 0.66483486 0.72990422 0.78894546 0.84147098
> .[ .[x*y ~ x <- 0:3] ~ y <- 0:4]
[,1] [,2] [,3] [,4] [,5]
[1,] 0 0 0 0 0
[2,] 0 1 2
2010 Feb 10
2
system.time provides inaccurate sys.child (PR#14210)
Full_Name: Manuel L?pez-Ib??ez
Version: R version 2.6.2 (2008-02-08)
OS: linux-gnu
Submission from: (NULL) (164.15.10.156)
This is only relevant for CPU intensive child processes. Otherwise, the problem
is not obvious.
Therefore, we need a CPU intensive program like this one:
/************************************/
/*** Compile with: gcc -o timer-test -O0 timer-test.c -lm */
#include
2011 Aug 17
1
multinomRob - error message
Hi,
I would like to use the multinomRob function to test election results.
However, depending on which independent variables I include and how
many categories I have in the dependent variable, the model cannot be
estimated.
My data look like this (there are 68 observations):
> head(database)
RESTE09 GAUCHE09 PDC09 PLR09 UDC09 MCG09 RESTE05 GAUCHE05 PDC05
D1 1455
2001 Dec 31
2
Extracting/setting elements from/in a matrix/array
Dear all,
I had to extracts/set elements from/in a matrix. Let say I have two
vectors dim1 and dim2 of indices in the respective two dimensions of a
matrix: I want to extract all the corresponding elements. I the case of a
nxn matrix, dim1 <- 1:n and dim2 <- 1:n would extract the diagonal.
I know one way would be to use the functions 'row' and 'col', but the
matrixes I
2012 Feb 25
5
which is the fastest way to make data.frame out of a three-dimensional array?
foo <- rnorm(30*34*12)
dim(foo) <- c(30, 34, 12)
I want to make a data.frame out of this three-dimensional array. Each dimension will be a variabel (column) in the data.frame.
I know how this can be done in a very slow way using for loops, like this:
x <- rep(seq(from = 1, to = 30), 34)
y <- as.vector(sapply(1:34, function(x) {rep(x, 30)}))
month <- as.vector(sapply(1:12,
2013 Dec 09
1
[PATCH] launch: switch from -nographic to -display none
The latter is a better way to disable the qemu display output as we
need to, without enabling extra devices (which are disabled already,
anyway).
Also, related to the change above, ban the -display parameter from the
ones that can be supplied by the user.
---
configure.ac | 8 ++++----
src/launch-direct.c | 12 ++++++++----
src/launch.c | 1 +
3 files changed, 13 insertions(+), 8
2010 Nov 08
1
unknown dimensions for loglm
Dear R-help community,
I am working with multidimensional contingency tables and I am having
trouble getting loglm to run on all dimensions without typing out each
dimension.
I have generated random data and provided output for the results I want
below:
d1.c1 <- rnorm(20, .10, .02)
d1.c2 <- rnorm(20, .10, .02)
d2.c1 <- rnorm(20, .09, .02)
d2.c2 <- rnorm(20, .09, .02)
d3.c1 <-
2012 Dec 07
1
points3d and ordirgl
Hello all, I have been using the function ordirgl to plot 3D dynamic
ordinations. The ordirgl function works just fine. IN fact, I was even
able to write a function that allows me to identify points in the 3D plot:
identify.rgl<-function(env_var,ord,dim1,dim2,dim3)
{
tmp<-select3d(button="left")
tmp.keep<-tmp(ord[,dim1],ord[,dim2],ord[,dim3])
2016 May 18
2
[PATCH v2 0/2] lib: qemu: Memoize qemu feature detection.
v1 -> v2:
- Rebase on top of Pino's version work.
Two patches went upstream, these are the two remaining patches.
Note the generation number is still inside the qemu.stat file. We
could put it in the filename, I have no particular preference.
Rich.
2011 May 10
3
metaMDS and envfit: Help reading output
Hello R experts,
I've used metaMDS to run NMDS on some fish abundance data, and am also working on correlating environmental data to the NMDS coordinates. I'm fairly new to metaMDS and NMDS in general, so I have what are probably some very basic questions. My fish abundance data consists of 66 sites for which up to 20 species of fish were identified and counted. I ran metaMDS on this data
2006 Dec 17
2
question
Dear R users,
I'am using marray and Limma packages to analyze genepix output.
1) how can I filter bad spots from my data (data contains 3 types of bad
spots).
my experiment contains 12 samples and the bad spot are not associated to the
same probes
2) how can I remove control probes from my data ?
I'm sorry, i'm new with R and I can't find answer in packages doc.
best regards,
2019 May 14
3
Unir coordenas en un plano mediante linea
Buenos días
--
Francisco Maturana Miranda
Dr. Planificación territorial, urbanismo y dinámicas del espacio
Profesor Asociado, Departamento de Geografía Universidad Alberto Hurtado
www.fmaturana.cl
[[alternative HTML version deleted]]
2008 Feb 23
2
counting sequence mismatches
Hello
I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this:
seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")
2007 Apr 10
2
time command
Hi
I am wanting to time how long it takes a couple commands to run.
I can do "time command" and it tells me.
How do I do multple commands at a time.
I tried:
time command; command
no good
time "command; command"
no good
I can make a script I guess but thought there was a more elegant way.
Thanks,
jerry
2012 Oct 17
3
subtotals based on price bands?
I would like to create a subtotal table with custom bands.
seq1 = seq(0, 100, by = 5)
seq2 = seq(100, 1000, by = 100)
Bands = c(seq1, seq2)
#Prices
Prices = sample(1:1000, 200, replace=F)
#corresponding size for the given price above.
size = sample(1:1000, 200, replace=F)
How would I find the subtotal of the size based on a given price falls
within a band?
--
View this message in
2011 Feb 05
1
different results in MASS's mca and SAS's corresp
Dear list:
I have tried MASS's mca function and SAS's PROC corresp on the
farms data (included in MASS, also used as mca's example), the
results are different:
R: mca(farms)$rs:
1 2
1 0.059296637 0.0455871427
2 0.043077902 -0.0354728795
3 0.059834286 0.0730485572
4 0.059834286 0.0730485572
5 0.012900181 -0.0503121890
6
2016 May 12
7
[PATCH 0/4] lib: qemu: Memoize qemu feature detection.
Doing qemu feature detection in the direct backend takes ~100ms
because we need to run `qemu -help' and `qemu -devices ?', and each of
those interacts with glibc's very slow link loader.
Fixing the link loader is really hard. Instead memoize the
output of those two commands.
This patch series first separates all the code dealing with qemu into
a separate module (src/qemu.c) and
2007 Dec 05
2
exim/kmail vs. dovecot
I am using exim via dovecot_deliver to store messages in Maildir in my $HOME.
I am using kmail to retrieve stuff. Unfortunately, something in my data
crashes dovecot.
I was using 1.0.rc14 from opensuse, but downloaded and installed 1.0.8 from
the site.
Here is the crash:
Dec 5 18:05:09 h743107 dovecot: IMAP(kris): file mail-index-transaction.c:
line 629 (mail_index_update_flags_range):
2017 Sep 11
4
[PATCH 0/4] lib: qemu: Add test for mandatory locking.
The patch I posted last week to disable mandatory locking for readonly
drives
(https://www.redhat.com/archives/libguestfs/2017-September/msg00013.html)
was wrong in a couple of respects. Firstly it didn't work, which I
didn't detect because my tests were testing the wrong thing. Oops.
Secondly it used a simple version number check to detect qemu binaries
implementing mandatory locking.