similar to: wilcox.test test statistic

Displaying 20 results from an estimated 7000 matches similar to: "wilcox.test test statistic"

2007 Jul 18
2
remove columns having a partial match name
Dear all, I would like to know how can I retrieve a data.frame without the columns that have a partial match name. Let´s say that I have a data.frame with 200 columns and 100 of them have the name "StartX", with X being the unique part for each column name. I want to delete all columns that have the name starting with "Start". I´ve tried to do this but it doesn´t work: >
2007 Jul 20
3
binned column in a data.frame
Dear all, I would like to know how can I create a binned column in a data.frame. The output that I would like is something like this: Start Binned_Start 1 0-5 2 0-5 6 5-10 8 5-10 13 10-15 ... Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers
2006 Oct 05
1
The W statistic in wilcox.exact
Does anyone know why wilcox.exact gives W-statistic 6 instead of 12 as indicated below. 12 is the rank sum of group 0 of x, which is the linear statistic computed by wilcox_test. y<-c(1,2,3,4,5) x<-c(1,1,0,0,0) (a) wilcox.exact wilcox.exact(y~x) Exact Wilcoxon rank sum test data: y by x W = 6, p-value = 0.2 alternative hypothesis: true mu is not equal to 0 (b) wilcox_test
2008 Apr 08
4
permutation test assumption?
Dear all, Can I do a permutation test if the number of individuals in one group is much bigger than in the other group? I searched the literature but I didin´t find any assumption that refers to this subject for permutation tests. Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O.
2007 Mar 23
2
concatenate 2 data.frames
Dear all, I would like to know how can I concatenate 2 data.frames into a single one. Both data frames have the same number of columns and the same class type in each correspondent column. So what I want is to have a new data.frame where I have first the values from one data.frame and then the values from a second data.frame would came after in this new data.frame. Thanks in advance. Med
2007 Jun 28
4
compare 2 vectors
Dear all, I would like to take out the values from one vector that are equal to the values in another vector. Example: a <- c(1,2,3,4,5,6,7,8,9) b <- c(3,10,20,5,6) b_noRepeats = c(10,20) So I would like to have the vector b without the same values as vector a. Kind regards, João Fadista [[alternative HTML version deleted]]
2011 Apr 28
3
Simple General Statistics and R question (with 3 line example) - get z value from pairwise.wilcox.test
Hi there, I am trying to do multiple pairwise Wilcoxon signed rank tests in a manner similar to: a <- c(runif(1000, min=1,max=50), rnorm(1000, 50), rnorm(1000, 49.9, 0.5), rgeom(1000, 0.5)) b <- c(rep("group_a", 1000), rep("group_b", 1000), rep("group_c", 1000), rep("group_d", 1000)) pairwise.wilcox.test(a, b, alternative="two.sided",
2007 Sep 05
6
length of a string
Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]
2007 Mar 30
1
Model comparison
Dear all, I would like to know if I can compare by a significance test 2 models with different kind of parameters. Perhaps I am wrong but I think that we can only compare 2 models if one is a sub model of the other. Med venlig hilsen / Regards João Fadista Ph.d. studerende / Ph.d. student AARHUS UNIVERSITET / UNIVERSITY OF AARHUS Det Jordbrugsvidenskabelige Fakultet / Faculty of
2019 Dec 07
2
Inconsistencies in wilcox.test
Thank you for a fast response. Nice to see this mailing list being so alive. Regarding Inf issue: I agree with your assessment that Inf should not be removed. The code gave me an impression that Inf values were intentionally removed (since is.finite() was used everywhere, except for paired case). I will try to adjust my patch according to your feedback. One more thing: it seems like you
2019 Dec 07
5
Inconsistencies in wilcox.test
Hello, Writing to share some things I've found about wilcox.test() that seem a a bit inconsistent. 1. Inf values are not removed if paired=TRUE # returns different results (Inf is removed): wilcox.test(c(1,2,3,4), c(0,9,8,7)) wilcox.test(c(1,2,3,4), c(0,9,8,Inf)) # returns the same result (Inf is left as value with highest rank): wilcox.test(c(1,2,3,4), c(0,9,8,7), paired=TRUE)
2007 Oct 10
1
subsetting a data.frame
Dear all, I would like to be able to subset a data.frame in a special way. I will put here an example: Score Name 88 000019_0070 88 000019_0070 87 000019_0070 79 002127_0658 79 002127_0658 77 002127_0658 So, for the above example I would like to have a new data.frame that has only the best "Score" for each
2007 Oct 31
1
find overlap between intervals
Dear all, I would like to be able to know the intervals of my data that overlap between them. Here it goes a small example: Input: Start End 440 443 380 443 290 468 Desired output: Start End 290 380 380 440 440 468 Best regards, João Fadista [[alternative HTML version deleted]]
2019 Dec 12
2
Inconsistencies in wilcox.test
>>>>> Karolis Koncevi?ius >>>>> on Mon, 9 Dec 2019 23:43:36 +0200 writes: > So I tried adding Infinity support for all cases. > And it is (as could be expected) more complicated than I thought. "Of course !" Thank you, Karolis, in any case! > It is easy to add Inf support for the test. The problems start with conf.int=TRUE.
2005 Mar 02
2
wilcox.test statistics
Hi, Could anyone provide the formula of the statistics which the wilcox.test used for the two-sample rank-sum test? I got some statistics of 0 values, but it is impossible to have 0 "rank-sum". Does the function use the Mann-Whitney U test statistics? Thanks. Ting-Yuan Liu
2011 Jun 14
4
BIZARRE results from wilcox.test()
I get these BIZARRE results from wilcox.test() When INCREASING the number of samples i get INCREASED p-values. When increasing the number of samples further, the p-values goes down again. This seems really bizarre! Can anyone explain why this is so?! Example: > w <- wilcox.test(c(1:40),(c(1:40)+100)) > w$p.value [1] 1.860340e-23 > w <- wilcox.test(c(1:50),(c(1:50)+100)) >
2007 Oct 09
1
read only certain parts of a file
Dear all, I would like to know how can I read a text file and create a data frame of only certain parts of the file. For instance, from this text file: =================================================== Matches For Query 0 (108 bases): 000019_0070 =================================================== Score Q_Name S_Name Q_Start Q_End S_Start S_End Direction Bases identity 89 000019_0070
2010 Oct 29
2
wilcox.test; data type conversion?
I'm working on a quick tutorial for my students, and was planning on using Mann-Whitney U as one of the tests. I have the following (fake) data grade <- c("MVG", "VG", "VG", "G", "MVG", "G", "VG", "G", "VG") sex <- c( "male", "male", "female", "male",
2010 Aug 09
1
Difference Between R: wilcox.test and STATA: signrank
This is my first post to the mailing list and I guess it's a pretty stupid question but I can't figure it out. I hope this is the right forum for these kind of questions. Before I started using R I was using STATA to run a Wilcoxon signed-rank test on two variables. See data below:
2002 Oct 15
2
V-value in the wilcox.test resp. wilcox.exact
hi, when performing a wilcox.test or a wilcox.exact i get results that looks like this: wilcox.exact(x, mu=.5) Exact Wilcoxon signed rank test data: x V = 207, p-value = 0.0006905 alternative hypothesis: true mu is not equal to 0.5 the way i understand the wilcox.test (or wilcox.exact) the V-value represents the summed up ranks of either the positive or negative differences,