similar to: concatenate 2 data.frames

Dear all, Can I do a permutation test if the number of individuals in one group is much bigger than in the other group? I searched the literature but I didin´t find any assumption that refers to this subject for permutation tests. Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O.

Good day everyone, Can anyone suggest an effective method to solve the following problem: I have 2 dataframes D1 and D2 as follows: D1: dates ws wc pwc 2005-10-19:12:00 10.8 80 81 2005-10-20:12:00 12.3 5 15 2005-10-21:15:00 12.3 3 15 2005-10-22:15:00 11.3 13 95 2005-10-23:12:00 12.3 13 2 2005-10-24:15:00 10.3 2 95 2005-10-25:15:00 10.3 2 2 D2:

Dear all, I would like to know if I can compare by a significance test 2 models with different kind of parameters. Perhaps I am wrong but I think that we can only compare 2 models if one is a sub model of the other. Med venlig hilsen / Regards João Fadista Ph.d. studerende / Ph.d. student AARHUS UNIVERSITET / UNIVERSITY OF AARHUS Det Jordbrugsvidenskabelige Fakultet / Faculty of

Dear all, I would like to know how can I create a binned column in a data.frame. The output that I would like is something like this: Start Binned_Start 1 0-5 2 0-5 6 5-10 8 5-10 13 10-15 ... Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers

Dear all, I would like to know how can I retrieve a data.frame without the columns that have a partial match name. Let´s say that I have a data.frame with 200 columns and 100 of them have the name "StartX", with X being the unique part for each column name. I want to delete all columns that have the name starting with "Start". I´ve tried to do this but it doesn´t work: >

Dear all, I would like to take out the values from one vector that are equal to the values in another vector. Example: a <- c(1,2,3,4,5,6,7,8,9) b <- c(3,10,20,5,6) b_noRepeats = c(10,20) So I would like to have the vector b without the same values as vector a. Kind regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I was trying to see how the function 'confint' is defined. Doing > confint function (object, parm, level = 0.95, ...) UseMethod("confint") <environment: namespace:stats> does not really enlighten me. How can I get to see the implementation (I guess it should be possible according to the general philosophy of the R project)? Thanks in advance S??ren

If I have a contourplot (in the lattice package) and I want to add straight lines to it, how do I do this? I see that there are llines() and lsegement() functions for lattice plots, but they don't seem to do anything in this case: library(lattice) library(KernSmooth) x=rnorm(10000) y=x+rnorm(x,0,.5) a=bkde2D(cbind(x,y),.7) z=as.vector(a$fhat) grid=expand.grid(x=a$x1,y=a$x2) grid$z=z

Dear all, I would like to be able to subset a data.frame in a special way. I will put here an example: Score Name 88 000019_0070 88 000019_0070 87 000019_0070 79 002127_0658 79 002127_0658 77 002127_0658 So, for the above example I would like to have a new data.frame that has only the best "Score" for each

Dear all, I would like to be able to know the intervals of my data that overlap between them. Here it goes a small example: Input: Start End 440 443 380 443 290 468 Desired output: Start End 290 380 380 440 440 468 Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I read a text file and create a data frame of only certain parts of the file. For instance, from this text file: =================================================== Matches For Query 0 (108 bases): 000019_0070 =================================================== Score Q_Name S_Name Q_Start Q_End S_Start S_End Direction Bases identity 89 000019_0070

Dear all, I would like to know how can I order a data.frame with increasing the dat$Interval (dat$Interval is a factor). There is an example below. Original data.frame: > dat Interval Number_reads 0-100 685 200-300 744 100-200 1082

Dear all, In S+, there are functions like create.ole.object call.ole.method release.ole.object for communicating with other programs which work as a COM server (on Windows). Is it possible to do something similar in R (I've studied the 'connections' facilities, but they do not seem to work). ========================================== S?ren H?jsgaard, PhD, Senior Scientist

Hello R-Users I am struggling with this line plot, it might be simple but I am missing something here. First of all I want to make multiple line plots across seasons (DJF,MAM,JJA,SON) for 12 variables (here, called nodes) and fill them with the node. So that season=x-axis, node=line col and freq=y-axis. My plot currently links all DJFs, MAMs, JJAs and SONs, however I will like them to be

Dear List-Members, since 3 weeks I have been heavily working on reproducing the results of an economic paper. The method there uses the numerical solution of an integral within nonlinear least squares. Within the integrand there is also some parameter to estimate. Is that in the end possible to implement in R [Originally it was done in GAUSS]? I'm nearly into giving up. I constucted an

Dear all, the application of the function rstandard() in the base package to a glm object does not produce residuals standardized to have variance one: the reason is that the deviance residuals are divided by the dispersion estimate and not by the square root of the estimate for the dispersion. Should the function not be changed to produce residuals with a variance about 1? R 1.8.1 on

Hi, I would like to know how can I keep adding data to a file while doing a loop and without deleting the data of the previous iteration. Thanks.

I am trying to extract only the winters (defined to be 01-Dec through 28-Feb) of daily data from 1948-2002. There are 90 days in each winter season. I wrote the following code to gather the winter dates into a single vector: DJF <- NULL for(year in 1949:1999) { temp.begin <- strptime(paste("01/12", year-1, sep="/"), "%d/%m/%Y") temp.end <-

Dear R users, I am currently working in subsetting a zooreg() object using either window or subset. I have a solution but it may be a bit cumbersome when I start working with actual data. Your inputs would be greatly appreciated. Example: I have a zooreg() object that starts in 1997 and ends in 2001. This object contains daily data for the 4 years