similar to: reposTools

Hiya, I am trying to look at the similarities between a number of sequences, for example i am trying to see how similar "ababbbassdaa" is to "addffggssbbsbbs" I was wondering is the some way for me to see how similar they are in terms of, for example, number of a's, number of b's, how often a and ab are consecutive, how often abab is together etc. Any advice

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

Hi, I have a string "GGGGGGCCCAATCGCAATTCCAATT" What I want to do is to count the percentage of each letter in the string, what string functions can I use to count the number of each letter appearing in the string? For example, the letter "A" appeared 6 times, letter "T" appeared 5 times, how can I use a string function to get the these number? thanks, karena

I figured most of it out. The Spec::Rails stuff was something in the code which has been fixed by revision 3099. The test methods partially make sense. Since the test/unit code has been integrated, methods with test in them are automatically turned into specs. However, the test? method is in a lib file that isn''t directly loaded into the specs. It is a convenience method: def

--Apple-Mail-1--963012407 Content-Transfer-Encoding: 7bit Content-Type: text/plain; charset=US-ASCII; format=flowed Hi, I get exactly the same error message as in report no 6920. Furthermore, starting "update Bioconducter" the following message appears (running Mac OS X 10.3.4 (7H63)) : > {library(reposTools);update.packages2(getAllDeps=TRUE)} Synching your local package

reposTools is part of Bioconductor not R. Please use the correct bug repository. Note that PR#6920 does not mention any `error message' whatsoever (nor does it claim to): the message quoted help.start() Making links in per-session dir ... If /usr/bin/open is already running, it is *not* restarted, and you must switch to its window. Otherwise, be patient ... is the standard

Full_Name: H Deshmukh Version: 2.0 OS: 2000 Submission from: (NULL) (129.174.206.239) Can somebody tell me what is it that i am doing wrong,i was not sure whether to post BioConductor error here or not. Thanks >source("http://www.bioconductor.org/getBioC.R") > getBioC(libName = "all") Running getBioC version 1.2.65.... If you encounter problems, first make sure that

Good day, The location of indels can be retrieved from a PairwiseAlignmentsSingleSubject object by using indel. Determining any difference between the two sequences, including substitutions, is not quick nor easy. I suppose that summary displays details of the mismatches, but the variable is of class PairwiseAlignmentsSingleSubjectSummary which has no documented accessors. So, the code to access

Dear list, I face some problems installing gpclib_1.0-1.tar.gz: R-161 R : Copyright 2002, The R Development Core Team Version 1.6.1 (2002-11-01) [...] system("R CMD INSTALL gpclib_1.0-1.tar.gz") WARNING: ignoring environment value of R_HOME ERROR: This R is version 1.5.0 package 'gpclib' depends on R 1.6.1 The same happens with http://www.bioconductor.org/getBioC.R

Hi, I was wondering I'm going about this in the correct way. I need to test if there are coding sequences or exons in hg19 which match a string of 100bp "D" i.e. [A,G or T]. However I'm getting a strange result. I get a hit on chr7, using the 100bp search however when I search with 60bp sequence of "D" I don't get any hits. library("BSgenome")

Hi again, I have been playing around with the order of loading packages, and as far as I can tell, there's nothing specific with affycoretools that's causing my Rgui to crash (i.e., shuts down and the Microsoft 'please send error report' box pops up). Instead, it has something to do with the order & type of packages that are loaded that add items to the menu bar by

Hi, I have built R (current development version) and BioConductor 1.7 with portland group compiler on a AMD Opteron. When I ran qc assessment on Affymetrix latin square data set, I got the following output, Loading required package: affy Loading required package: Biobase Loading required package: tools Welcome to Bioconductor Vignettes contain introductory material. To view,

Hello , I am not sure what the best solution is, but, in my hands using Org-mode version 8.3.2-elpa org-20150929 the reg-expt used to "cleanup extra prompts left in output" is over-aggressive and will trim session :output at lines consisting exclusively of blanks and periods such as produced when printing a BioConductor 'Views' object which wants to appear as #+RESULTS:

...unless its me missing something... > help.search("prompt", agrep=F) Error: couldn't find function ".class1" > traceback() 12: initialize(value, ...) 11: initialize(value, ...) 10: new("ObjectsWithPackage", value, package = pkg) 9: metaNameUndo(unique(these), prefix = "M", searchForm = searchForm) 8: methods:::getGenerics(ns) 7:

Hi I am running R 2.0 on Suse Linux 8.2. I get an error message when loading a library: "Incorrect permissions to edit the package database, /usr/lib/R/library/liblisting.Rda: save.locLib(locLibList, curLib)" However, when I look at that file, the user I am running R as has r and w permissions on it.... So firstly - any ideas why I get this error message? And secondly, does it

Hi everyone, My purpose is to read a .CEL file into R. The .CEL file was created from a .CAB by using DTT software found on Affymetrix website I read the .CEL file in R using ReadAffy as follows: > d2=ReadAffy(widget=T) and I complete the fields as required. It does not complain. For example I could find the description: > description(d2) Experimenter name: BB Laboratory: FFL Contact

The Bioconductor development team announces release 1.1 of the Bioconductor packages for the analysis of genomic data. Bioconductor is an open source bioinformatics software project based on R. Version 1.1 features: ===================== * All packages from the 1.0 release are included. All current bug fixes have been applied, and most have upgraded and provide enhanced functionality. *

The Bioconductor development team announces release 1.1 of the Bioconductor packages for the analysis of genomic data. Bioconductor is an open source bioinformatics software project based on R. Version 1.1 features: ===================== * All packages from the 1.0 release are included. All current bug fixes have been applied, and most have upgraded and provide enhanced functionality. *

Sorry to ask a (probably) dumb question, but I am trying to install XML package on Windows XP, R 2.0.1, and I get the error: "This application has failed to start because libxml2.dll was not found. Re-installing the application may fix this problem" > library(XML) Error in dyn.load(x, as.logical(local), as.logical(now)) : unable to load shared library

Hi How do I install "gregmisc" packages? I did- % sudo R > install.packages("gregmisc") . . > barplot2() but, Error: couldn't find function "barplot2" -- atuya Mac OSX 10.2.6 R 1.7.1