similar to: Working with a set of matrices

Hi Is it possible to subset an n-dimensional array by a vector of n dimensions? E.g. assume I have > x <- array(1:24, dim=2:4) > x[1,1,2] [1] 7 > dims <- c(1,1,2) I would like a function that I can supply x and dims as parameters to, and have it return 7. Also, I would like to do something like: > x[1,1,] [1] 1 7 13 19 > dims2<- c(1,1,NA) And have a function of x and

Dear all, is there a good way to create SVG plots with R whose elements have titles (tooltips) or act as hyperlinks? I am using the RSvgDevice package, which works great - but it doesn't seem to support the notion that plot objects have titles or are act as hyperlinks, so I am helping myself by giving the objects funny unique colors and then postprocessing the .svg file. I wonder

Hi, I am finding the recently added [1] functionality of embedding raster images into plots on R devices very useful! Thanks to Paul Murrell and others for providing that. I noted that in https://svn.r-project.org/R/trunk/src/library/grDevices/src/devPS.c a macro is defined: #define MAX_RASTERS 64, and consequently, I get Error in grid.Call.graphics("L_raster", x$raster, x$x, x$y,

Hi, when running the following on a fresh R, library("IRanges") annotation showMethods("annotation") Biobase:::annotation showMethods("annotation") I get (see the "^^^^^" marked output at the bottom): > library("IRanges") Carico il pacchetto richiesto: 'IRanges' The following object(s) are masked from package:base :

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

Dear all, I have a code chunk in my Rnw file that, when executed, outputs carriage return characters ('\r') to inform on the progress (e.g. "sweep 4 of 1024\r"). But Sweave interprets this as a newline character, and therefore I get countless pages of output in my vignette where I only really want one line. Any ideas? Thanks E

Hi, I run into following error when using heatmap() for data matrix "xx". Any help is appreciated? "xx" contains many "NA"s. > hv <- heatmap(data.matrix(xx)) Error in hclustfun(distfun(if (symm) x else t(x))) : NA/NaN/Inf in foreign function call (arg 11) Thanks a lot. Yuhong

Greetings, I have "inherited" a cDNA macroarray dataset that is structured as follows. Three different stressors were tested. For each stressor, there are two treatments (control and stressed). For each treatment, two biological replicates exist, and these are paired (i.e., there is a stressed array for colony A and a control array from this same colony). For one of these samples,

Good day, The use of "rounding" also doesn't make sense. If The number is halfway between two integers, it is rounded to the nearest even integer. > round(2.5) [1] 2 -------------------------------------- Dario Strbenac University of Sydney Camperdown NSW 2050 Australia

R 2.5.1 on WinXP I'm trying to create new variables in a dataframe called jaw, as powers of jaw$age up to the sixth power, and name them jaw$age.(--the digit corresponding to the power--) Obviously none of these work (silly for me to try, I suppose): for (i in 2:6) { jaw$age.'i' <- jaw$age^i } for (i in 2:6) { jaw$age.i <- jaw$age^i } for (i in 2:6) {

Deal all, new as I am to developing packages for R-Project, I apologize on beforehand for questions that are too obvious. I am trying to 'add' a PDF document containing some detailed information to a package. The way I understand the Rexts.pdf document, I should add my .PDF document to the /inst/doc/ folder, and links to the files should be build automatically. However, after

Hi, I was checking the source code to the function combn that "generates all combinations of the elements of 'x' taken 'm' at a time.", because I wished to modify it. I have a doubt about a statement. This is the main loop. ._1 <- 1:1 nmmp1 <- n - m + ._1 while (a[1] != nmmp1) { if (e < n - h) { h <- ._1 e <-

I'm working with a genomic data-set with ~31k end-points and have performed an F-test across 5 groups for each end-point. The QA measurments on the individual micro-arrays all look good. One of the first things I do in my work-flow is take a look at the p-valued distribution. it is my understanding that, if the findings are due to chance alone, the p-value distribution should be uniform. In

Dear all, Since my package is based on S4 classes, I would like to know how to add a slot to an existing S4 class without breaking the code of users of my package. Assume the following S4 class: setClass("MyClass", representation(name = "character", type = "character", data = "data.frame" ), prototype(name =

Dear colleagues, I wish to report a problem I encounter when trying to save a graphic to file. When I produce a graphic and try to save it R becomes unresponsive and I must force quit, and then restart R. The problem occurs when I try to overwrite an existing graphic: for example when I made changes to the graphic and want to save the graphic using the original file name. It only happens when I

Since now many browsers support (ECMA/Java-)scripted SVG, I am wondering whether there are already any examples of inserting R code into SVG documents (or a Javascript canvas?) either directly, or perhaps more likely through a JavaScript layer, to dynamically generate graphics or make them interactive? I am aware of the excellent packages gridSVG and SVGAnnotation, which facilitate making

Um texto embutido e sem conjunto de caracteres especificado associado... Nome: n?o dispon?vel Url: https://stat.ethz.ch/pipermail/r-help/attachments/20080208/bf7b4696/attachment.pl

My machine has 8GB memory. I had quit all other programs that might take a lot of memory when I try the script (before I post the first message in this thread). The cdf file is of only 741 MB. It is strange to me to see the error. On Mon, Dec 28, 2009 at 2:38 AM, Wolfgang Huber <whuber at embl.de> wrote: > Dear Peng Yu > > how big is the RAM of your computer? You could try with

Dear Wolfgang, Thanks for your response. No, I haven't tried doing the complete reinstallation as you suggest. If I recall correctly, this has happened on previous occasions but like I said in my email it's not all that disruptive to my workflow. It's more like a 'first world problem'. I was encouraged to submit the query because I had correspondence with someone involved

I try to sort this dataframe: [,1] [,2] [,3] [,4] [,5] [,6] [,7] [,8] [1,] "CM" "BARBY" "INCREASED" " 0" " 2" " 0" " 1" " 1" [2,] "CM" "BARBY" "REDUCED" " 0" " 1" " 2" " 2" " 5" [3,] "CM"