similar to: Non-linear minimization

I'm probably misunderstanding something in "Writing R Extensions" version 1.0.0. In the chapter on the R API, section 4.7, it is stated that the functions listed in R_ext/Linpack.h are available to users' Fortran code. I am developing a developing a library of ode solvers, based on lsoda and ddassl, and which in turn call some routines from linpack and double precision blas. I

Hi, Does somebody knows of the existence of a library of functions for solving differential equations, I need a solver for a system of non linear first order differential equations. I think there was something in IMSL but that was a long time ago and probably there are some new algorithms in the new now. Thanks for any pointers. . R. Heberto Ghezzo Ph.D. Meakins-Christie Labs McGill

I would like to import "tif" images in R and I do not find any function that can do that. In Matlab there exists the function "imread" that can read the most known images format. Does a similar function exist for R ? Thanks in advance -- Herve CARDOT ____________________________________________________________ Unite Biometrie et Intelligence Artificielle, INRA Toulouse BP

Hi, I'm trying to make a regression of the form : formula <- y ~ Asym_inf + Asym_sup * ( (1 / (1 + (n1 * (exp( (tmid1-x) / scal1) )^(1/n1) ) ) ) - (1 / (1 + (n2 * (exp( (tmid2-x) / scal2) )^(1/n2) ) ) ) ) which is a sum of the generalized logistic model proposed by richards. with data such as these: x <- c(88,113,128,143,157,172,184,198,210,226,240,249,263,284,302,340) y <-

Dear experts! I have a minimization problem with non-linear constraint and Objective function(theta)=lambda*(Constr)^2-f(x,theta). Theta is a vector of parameters. I'd like to stop the optimization after the value of the constraint is less or equal some constant value, say d, and save the last computed value of the function. For this purpose, I thought to define the Objective function like

Le 17/12/2023 ? 18:26, Barry Rowlingson a ?crit?: > I think what's been missed is that zapsmall works relative to the absolute > largest value in the vector. Hence if there's only one > item in the vector, it is the largest, so its not zapped. The function's > raison d'etre isn't to replace absolutely small values, > but small values relative to the largest.

Hi Thanks for your suggestion, I'm trying to install this package in Ubuntu (7.10) but unsuccessfully. Also tried in MacOSX, and no success too. _____ De: Ndoye Souleymane [mailto:ndoye_p@hotmail.com] Enviado el: miércoles, 05 de diciembre de 2007 13:38 Para: bady@univ-lyon1.fr; Florencio González CC: r-help@stat.math.ethz.ch Asunto: RE: [R] confidence intervals for y predicted in

Le 18/12/2023 ? 11:24, Martin Maechler a ?crit?: >>>>>> Serguei Sokol via R-devel >>>>>> on Mon, 18 Dec 2023 10:29:02 +0100 writes: > > Le 17/12/2023 ? 18:26, Barry Rowlingson a ?crit?: > >> I think what's been missed is that zapsmall works relative to the absolute > >> largest value in the vector. Hence if

>>>>> Serguei Sokol via R-devel >>>>> on Mon, 18 Dec 2023 10:29:02 +0100 writes: > Le 17/12/2023 ? 18:26, Barry Rowlingson a ?crit?: >> I think what's been missed is that zapsmall works relative to the absolute >> largest value in the vector. Hence if there's only one >> item in the vector, it is the largest, so its

I think what's been missed is that zapsmall works relative to the absolute largest value in the vector. Hence if there's only one item in the vector, it is the largest, so its not zapped. The function's raison d'etre isn't to replace absolutely small values, but small values relative to the largest. Hence a vector of similar tiny values doesn't get zapped. Maybe the line

Good morning gentlemen! How using a weighted model in nls2? Values with the nls are logical since values with nls2 are not. I believe that this discrepancy is due to I did not include the weights argument in nls2. Here's an example: MOISTURE <- c(28.41640, 28.47340, 29.05821, 28.52201, 30.92055, 31.07901, 31.35840, 31.69617, 32.07168, 31.87296, 31.35525, 32.66118, 33.23385,

Dear All, I was trying to call a self-defined function that performs nonlinear regression and gets the corresponding prediction upper limit using nls2 package. However, weird thing happened. When I called the function in the main program, an error message "fitted(nlsmodel): object 'nlsmodel' not found" came up. But when I directly ran the codes inside the function, no error came

hey, I can not find a function for the following problem, hopefully you can help me. I have a vactor like this one v = c(NA,NA,TRUE,TRUE,NA,TRUE,NA,TRUE,TRUE,TRUE) and I would like to the TRUE values by the their "local sequence number". This means, the result should look thike this: c(NA,NA,1,2,NA,1,NA,1,2,3) Of course I could solve the problems using a loop, but this would be

I have re-labeled tick marks on the x axis. The problem is that by using axes=FALSE, the axes disappears and when they are called back using axis(side=1)..etc. the axis on sides 1 and 2 do not meet at the bottom left corner of the graph. I would also like to have the 3rd and 4th axes in there as well, all meeting in their respective corners. par(mfrow=c(1,2)) gut<-c("Full",

Does anyone know of a cross browser solution to print a page/url after a user clicks a button? Currently, I''m using a "hidden" iframe to do my bidding. But from my experience, IE requires that the iframe''s src attribute be set initially to the url, in order for the page to open properly. I wasn''t able to add the iframe to the page dynamically, either. So

Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context:

Good morning gentlemen! When I use the function nls2, and store it in an object, that object is automatically printed, without the summary or to draw the object. For example. model <- nls2 (...) Number of iterations to convergence: ... Achieved convergence tolerance: ... Nonlinear regression model model: ... ~ ... Date: NULL The B k ... ... ... residual sum-of-squares: ... Number

Hello Everyone, I am having problem in defining specific axis for plotting a vactor. vecAVG <- c(0.2, 0.4, 0.6, 0.2, 0.4) names(vecAVG)<-c("brain","heart","kidney","lung","blood") par(mar=c(12,4.1,4.1, 2.1))

Does mFUN() really need to be a function of x and the NA values of x? I can't think of a case where it would be used on anything but the non-NA values of x. I think it would be easier to specify a different mFUN() (and document this new argument) if the function has one argument and is applied to the non-NA values of x. zapsmall <- function(x, digits = getOption("digits"),

Dear Madam or sir, Does anyone know if there is a pre-compiled version of package nls2 for windows, please? Thank you. Souleymane