Displaying 20 results from an estimated 4000 matches similar to: "Non-linear minimization"
2000 Apr 15
2
unresolved symbols in dynamically linked code
I'm probably misunderstanding something in "Writing R Extensions" version
1.0.0. In the chapter on the R API, section 4.7, it is stated that the
functions listed in R_ext/Linpack.h are available to users' Fortran code.
I am developing a developing a library of ode solvers, based on lsoda and
ddassl, and which in turn call some routines from linpack and double
precision blas. I
2000 Jul 26
4
differential equations
Hi, Does somebody knows of the existence of a library of functions
for solving differential equations, I need a solver for a system of non
linear first order differential equations. I think there was something
in IMSL but that was a long time ago and probably there are some
new algorithms in the new now.
Thanks for any pointers.
.
R. Heberto Ghezzo Ph.D.
Meakins-Christie Labs
McGill
2002 Feb 20
3
importing images
I would like to import "tif" images in R and I do not find any
function that can do that. In Matlab there exists the function "imread"
that can read the most known images format. Does a similar function
exist for R ?
Thanks in advance
--
Herve CARDOT
____________________________________________________________
Unite Biometrie et Intelligence Artificielle, INRA Toulouse
BP
2010 Jan 13
1
Problem fitting a non-linear regression model with nls
Hi,
I'm trying to make a regression of the form :
formula <- y ~ Asym_inf + Asym_sup * ( (1 / (1 + (n1 * (exp( (tmid1-x)
/ scal1) )^(1/n1) ) ) ) - (1 / (1 + (n2 * (exp( (tmid2-x) / scal2)
)^(1/n2) ) ) ) )
which is a sum of the generalized logistic model proposed by richards.
with data such as these:
x <- c(88,113,128,143,157,172,184,198,210,226,240,249,263,284,302,340)
y <-
2005 Mar 24
1
How to stop the minimization when the condition does not hold
Dear experts!
I have a minimization problem with non-linear constraint and Objective
function(theta)=lambda*(Constr)^2-f(x,theta). Theta is a vector of
parameters.
I'd like to stop the optimization after the value of the constraint is less
or equal some constant value, say d, and save the last computed value of the
function.
For this purpose, I thought to define the Objective function like
2023 Dec 18
1
[External] Re: zapsmall(x) for scalar x
Le 17/12/2023 ? 18:26, Barry Rowlingson a ?crit?:
> I think what's been missed is that zapsmall works relative to the absolute
> largest value in the vector. Hence if there's only one
> item in the vector, it is the largest, so its not zapped. The function's
> raison d'etre isn't to replace absolutely small values,
> but small values relative to the largest.
2007 Dec 05
1
confidence intervals for y predicted in non linearregression
Hi Thanks for your suggestion, I'm trying to install this package in Ubuntu
(7.10) but unsuccessfully. Also tried in MacOSX, and no success too.
_____
De: Ndoye Souleymane [mailto:ndoye_p@hotmail.com]
Enviado el: miércoles, 05 de diciembre de 2007 13:38
Para: bady@univ-lyon1.fr; Florencio González
CC: r-help@stat.math.ethz.ch
Asunto: RE: [R] confidence intervals for y predicted in
2023 Dec 18
1
[External] Re: zapsmall(x) for scalar x
Le 18/12/2023 ? 11:24, Martin Maechler a ?crit?:
>>>>>> Serguei Sokol via R-devel
>>>>>> on Mon, 18 Dec 2023 10:29:02 +0100 writes:
> > Le 17/12/2023 ? 18:26, Barry Rowlingson a ?crit?:
> >> I think what's been missed is that zapsmall works relative to the absolute
> >> largest value in the vector. Hence if
2023 Dec 18
1
[External] Re: zapsmall(x) for scalar x
>>>>> Serguei Sokol via R-devel
>>>>> on Mon, 18 Dec 2023 10:29:02 +0100 writes:
> Le 17/12/2023 ? 18:26, Barry Rowlingson a ?crit?:
>> I think what's been missed is that zapsmall works relative to the absolute
>> largest value in the vector. Hence if there's only one
>> item in the vector, it is the largest, so its
2023 Dec 17
2
[External] Re: zapsmall(x) for scalar x
I think what's been missed is that zapsmall works relative to the absolute
largest value in the vector. Hence if there's only one
item in the vector, it is the largest, so its not zapped. The function's
raison d'etre isn't to replace absolutely small values,
but small values relative to the largest. Hence a vector of similar tiny
values doesn't get zapped.
Maybe the line
2010 Sep 02
1
How using the weights argument in nls2?
Good morning gentlemen!
How using a weighted model in nls2? Values with the nls are logical since
values with nls2 are not. I believe that this discrepancy is due to I did
not include the weights argument in nls2.
Here's an example:
MOISTURE <- c(28.41640, 28.47340, 29.05821, 28.52201, 30.92055,
31.07901, 31.35840, 31.69617, 32.07168, 31.87296, 31.35525, 32.66118,
33.23385,
2013 Jan 02
1
Need help with self-defined function to perform nonlinear regression and get prediction interval
Dear All,
I was trying to call a self-defined function that performs nonlinear
regression and gets the corresponding prediction upper limit using nls2
package. However, weird thing happened. When I called the function in the
main program, an error message "fitted(nlsmodel): object 'nlsmodel' not
found" came up. But when I directly ran the codes inside the function, no
error came
2009 Jul 15
3
Axes origins and labeling
I have re-labeled tick marks on the x axis. The problem is that by using
axes=FALSE, the axes disappears and when they are called back using
axis(side=1)..etc. the axis on sides 1 and 2 do not meet at the bottom left
corner of the graph. I would also like to have the 3rd and 4th axes in
there as well, all meeting in their respective corners.
par(mfrow=c(1,2))
gut<-c("Full",
2006 May 09
8
Dynamically printing a page
Does anyone know of a cross browser solution to print a page/url after a
user clicks a button?
Currently, I''m using a "hidden" iframe to do my bidding. But from my
experience, IE requires that the iframe''s src attribute be set initially to
the url, in order for the page to open properly. I wasn''t able to add the
iframe to the page dynamically, either.
So
2009 Sep 14
4
local sequence function
hey,
I can not find a function for the following problem, hopefully you can
help me.
I have a vactor like this one
v = c(NA,NA,TRUE,TRUE,NA,TRUE,NA,TRUE,TRUE,TRUE)
and I would like to the TRUE values by the their "local sequence
number".
This means, the result should look thike this:
c(NA,NA,1,2,NA,1,NA,1,2,3)
Of course I could solve the problems using a loop, but this would be
2010 Jan 26
4
reading a string vector
Hi, I need to read a string vector in R which is like this
"atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as
a unique vector input when I read in like x <-
"atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I
can use each of the letters on my reading?
Thanks,
Beatriz
--
View this message in context:
2010 Nov 24
1
The nls2 function automatically prints the object!
Good morning gentlemen!
When I use the function nls2, and store it in an object, that object is
automatically printed, without the summary or to draw the object. For
example.
model <- nls2 (...)
Number of iterations to convergence: ...
Achieved convergence tolerance: ...
Nonlinear regression model
model: ... ~ ...
Date: NULL
The B k
... ... ...
residual sum-of-squares: ...
Number
2023 Dec 18
1
[External] Re: zapsmall(x) for scalar x
Does mFUN() really need to be a function of x and the NA values of x? I
can't think of a case where it would be used on anything but the non-NA
values of x.
I think it would be easier to specify a different mFUN() (and document this
new argument) if the function has one argument and is applied to the non-NA
values of x.
zapsmall <- function(x,
digits = getOption("digits"),
2011 May 03
3
Axis trouble
Hello Everyone,
I am having problem in defining specific axis for
plotting a vactor.
vecAVG <- c(0.2, 0.4, 0.6, 0.2, 0.4)
names(vecAVG)<-c("brain","heart","kidney","lung","blood")
par(mar=c(12,4.1,4.1, 2.1))
2004 Jul 22
1
package nls2 for windows
Dear Madam or sir,
Does anyone know if there is a pre-compiled version of package nls2 for
windows, please?
Thank you.
Souleymane