similar to: Vector and String

Dear Any, Is there a fonction in R to change a string to uppercase ? Thanks for all your help

Dear all, I am developing a GUI in perl-Tk and I would use R engine to make some analysis and some plots. I have seen that the package RSPerl allows R from perl exchanges but this package is developed on and for intel based computers. When I try to install the package on solaris I have some errors has somebody already used RSPerl on solaris ? Many thanks, Patrick

Hi everybody !! I have a vector named v1 with a lot of values from 0 to 10. Is there a solution to replace all 0 by 1 ?? I have tried with a 'FOR' loop... Thank you very much

Hi, I have made a GUI in PerlTk and I would use R within perl. I actually try to install RSPerl but I have some problems during the compilation In order to call R from perl I use actually an other system based on the OPEN command in perl. It works fine but when I tried to call the fonction plot() of R from perl the plot do not appears and a file named plot.ps is generated. Unfortunalelly, my

I am using exim via dovecot_deliver to store messages in Maildir in my $HOME. I am using kmail to retrieve stuff. Unfortunately, something in my data crashes dovecot. I was using 1.0.rc14 from opensuse, but downloaded and installed 1.0.8 from the site. Here is the crash: Dec 5 18:05:09 h743107 dovecot: IMAP(kris): file mail-index-transaction.c: line 629 (mail_index_update_flags_range):

Hello I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")

R-users, I have two vectors (of timestamps) d1 <- as.POSIXct(strptime("2.2.2002 07:00", format="%d.%m.%Y %H:%M")) d2 <- as.POSIXct(strptime("4.2.2002 07:00", format="%d.%m.%Y %H:%M")) seq1 <- seq(d1, d2, "hours") seq1 d3 <- as.POSIXct(strptime("2.2.2002 15:22", format="%d.%m.%Y %H:%M")) d4 <-

I would like to create a subtotal table with custom bands. seq1 = seq(0, 100, by = 5) seq2 = seq(100, 1000, by = 100) Bands = c(seq1, seq2) #Prices Prices = sample(1:1000, 200, replace=F) #corresponding size for the given price above. size = sample(1:1000, 200, replace=F) How would I find the subtotal of the size based on a given price falls within a band? -- View this message in

I have three character strings represented below as seq1, seq2, and seq3. Each string has a reference character different from the other. Thus, for seq1, the reference character is U, seq2, S (3rd S from left where A is leftmost character) and for seq3 Y. seq1 = PQRTUWXYseq2 = AQSDSSDHRSseq3 = EEZYJKFFBHO I wish to generate a 3 by 26 matrix where 3 represent seq1, seq2, seq3 and 26 the letters of

Hi, I have two lists 1) List1- 30,000 rows and 104 columns 2) List2- a list of 14000 selected rownames  from List 1 Now, I want to extract all the 104 columns of List1  matching with the 14000 selected rownames from List2.  Psedocode will be something like this: match rownames(List2) with rownames(List1) extract selected matched 104 coloumns from (List1) strore in-> List3 So the

Great R people, I have noticed a strange behaviour in read.delim() and friends in the R 2.7.0 version. I will describe you the problem and also the solution I already found, just to be sure it is an expected behaviour and also to tell people, who may experience the same difficulty, a way to overcome it. And also to see if it is a proper behaviour or maybe a correction is needed. Here is the

Dear RRRRRrrrrrrrrlist! I?ve got two lists which contain sets of DNA-sequences. They look something like this: List of 33 $ Cunonia_atrorubens : chr [1:247] "t" "t" "n" "t" ... $ Cunonia_balansae : chr [1:254] "t" "c" "c" "c" ... $ Cunonia_capensis : chr

Hello, I am trying to loop through a matrix column and find the first value <=0 and store that matrix location in a variable called Start. I have tried the following: i <- 1 j <- 1 while (Matrix[i, j] > 0) i = (i + 1) #loop until matrix [i, j] value <= 0 #strore that row number in a variable Start <- i I am getting a scripting out of bounds error and I suspect maybe the loop

Thanks -- I'll commit a fix after some testing. Best, luke On 04/29/2018 06:22 AM, Duncan Murdoch wrote: > On 28/04/2018 11:11 PM, Suharto Anggono Suharto Anggono via R-devel wrote: >>> .Internal(inspect(1:10)) >> @300e4e8 13 INTSXP g0c0 [NAM(3)]? 1 : 10 (compact) >>> .Internal(inspect(seq(1,10))) >> @3b6e1f8 13 INTSXP g0c4 [] (len=10, tl=0) 1,2,3,4,5,...

Hi list, Some years ago, here at University of Poitiers, we used something called Netware. But it was expensive, so it was decided to abandonned it : some services migrated to samba and OpenLDAP, and others migrated to Windows Server. So now, Win7 is coming, and unfortunately we can't use Samba2 anymore. So the solution should be to use Samba3, wich supports Win7. But (yes there is

I started using robotcoop''s CachedModel class in my project but have encountered problems when using it with the acts_as_ferret plugin. It seems it doesn''t index everything in my STI model, also if I do a search from my base STI class I get a result count but no results. If I run the same search from one of the children STI models I get the appropriate results (if the information

Hello Julien, Am Tue, 15 Jan 2019 09:30:23 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > In that case I see: > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq1, length 64 > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq2, length 64 > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq3, length 64 > > Packet goes

Hi, today I have built dovecot from cvs sources, and upgraded server from beta-7 to this newer version. Then i got problems with opening INBOX using thunderbird 1.5.0.2. The client says "Opening folder...", then, after about half a minute, blinking "connecting to the server" and returning to "Opening folder..." /var/log/maillog gets the messages: --- Jun 22

Hi, I have yet another problem with Dovecot: sometimes (rarely, maybe once every few days) one of the imap processes will 'hang', consuming all available CPU time. It does not seem to 'finish' in any reasonable amount of time (in one instance I waited a few days). This process will not even exit gracefully, it needs to be killed with 'kill -9 <PID>'. It has

Below is code that introduces a list comprehension syntax into R, allowing expressions like: > .[ sin(x) ~ x <- (0:11)/11 ] [1] 0.00000000 0.09078392 0.18081808 0.26935891 0.35567516 0.43905397 [7] 0.51880673 0.59427479 0.66483486 0.72990422 0.78894546 0.84147098 > .[ .[x*y ~ x <- 0:3] ~ y <- 0:4] [,1] [,2] [,3] [,4] [,5] [1,] 0 0 0 0 0 [2,] 0 1 2